Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0713020569:

Variant ID: vg0713020569 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 13020569
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACACCGGCGGAAGCTAGGGTTAACAAATCCACTCCAATCCATCCTCCTGAGCTCCACAAAAACCCTCCACGCAACCACCGCACCGAATCCCCATCCATT[T/C]
CCAGCCATATCTCGGACCAAATCACACCATCCAGTTCGTATTCATGACGGAAGAGAGAGAAAGCTTCGAGAGTCAGTGGGCGCCCTCCGATGTAACAGAG

Reverse complement sequence

CTCTGTTACATCGGAGGGCGCCCACTGACTCTCGAAGCTTTCTCTCTCTTCCGTCATGAATACGAACTGGATGGTGTGATTTGGTCCGAGATATGGCTGG[A/G]
AATGGATGGGGATTCGGTGCGGTGGTTGCGTGGAGGGTTTTTGTGGAGCTCAGGAGGATGGATTGGAGTGGATTTGTTAACCCTAGCTTCCGCCGGTGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.30%	0.10%	3.96%	53.66%	NA
All Indica	2759	24.10%	0.10%	6.02%	69.77%	NA
All Japonica	1512	80.10%	0.00%	0.53%	19.38%	NA
Aus	269	22.30%	0.00%	1.86%	75.84%	NA
Indica I	595	45.50%	0.00%	0.67%	53.78%	NA
Indica II	465	17.60%	0.00%	9.68%	72.69%	NA
Indica III	913	10.80%	0.00%	8.00%	81.16%	NA
Indica Intermediate	786	27.10%	0.40%	5.60%	66.92%	NA
Temperate Japonica	767	75.50%	0.00%	0.78%	23.73%	NA
Tropical Japonica	504	86.30%	0.00%	0.00%	13.69%	NA
Japonica Intermediate	241	81.70%	0.00%	0.83%	17.43%	NA
VI/Aromatic	96	18.80%	0.00%	4.17%	77.08%	NA
Intermediate	90	51.10%	0.00%	4.44%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0713020569	T -> DEL	N	N	silent_mutation	Average:16.479; most accessible tissue: Callus, score: 35.347	N	N	N	N
vg0713020569	T -> C	LOC_Os07g23080.1	upstream_gene_variant ; 251.0bp to feature; MODIFIER	silent_mutation	Average:16.479; most accessible tissue: Callus, score: 35.347	N	N	N	N
vg0713020569	T -> C	LOC_Os07g23090.1	upstream_gene_variant ; 44.0bp to feature; MODIFIER	silent_mutation	Average:16.479; most accessible tissue: Callus, score: 35.347	N	N	N	N
vg0713020569	T -> C	LOC_Os07g23070.1	downstream_gene_variant ; 2763.0bp to feature; MODIFIER	silent_mutation	Average:16.479; most accessible tissue: Callus, score: 35.347	N	N	N	N
vg0713020569	T -> C	LOC_Os07g23100.1	downstream_gene_variant ; 4082.0bp to feature; MODIFIER	silent_mutation	Average:16.479; most accessible tissue: Callus, score: 35.347	N	N	N	N
vg0713020569	T -> C	LOC_Os07g23080-LOC_Os07g23090	intergenic_region ; MODIFIER	silent_mutation	Average:16.479; most accessible tissue: Callus, score: 35.347	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0713020569	NA	1.56E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713020569	NA	2.18E-06	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713020569	5.16E-06	5.07E-08	mr1892_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0713020569	NA	1.11E-07	mr1892_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251