\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712954506:

Variant ID: vg0712954506 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 12954506
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCTGCTGTCAACACCTGGAACAAATGCTCTACATCATTCCTCTTGAAATTCTTCCCGATGGACAAAACCAATGCCCTTCGTGGAAGGATTTCCAGTTTC[T/C]
AGCAGACAAGGGACGAGTCTATTCTAGAAACATGGGAACGACTGCAGGAGTACGTGGCCGCCTGTCCTCATCATGGGATGGACGACTGGCTGATCCTGCA

Reverse complement sequence

TGCAGGATCAGCCAGTCGTCCATCCCATGATGAGGACAGGCGGCCACGTACTCCTGCAGTCGTTCCCATGTTTCTAGAATAGACTCGTCCCTTGTCTGCT[A/G]
GAAACTGGAAATCCTTCCACGAAGGGCATTGGTTTTGTCCATCGGGAAGAATTTCAAGAGGAATGATGTAGAGCATTTGTTCCAGGTGTTGACAGCAGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.80% 29.60% 28.54% 4.00% NA
All Indica  2759 15.30% 42.80% 39.04% 2.83% NA
All Japonica  1512 81.50% 3.40% 8.20% 6.81% NA
Aus  269 28.30% 44.60% 25.28% 1.86% NA
Indica I  595 20.70% 27.60% 49.08% 2.69% NA
Indica II  465 26.20% 35.10% 35.05% 3.66% NA
Indica III  913 3.80% 59.00% 34.94% 2.19% NA
Indica Intermediate  786 18.20% 40.10% 38.55% 3.18% NA
Temperate Japonica  767 77.70% 2.20% 7.17% 12.91% NA
Tropical Japonica  504 87.50% 3.40% 8.93% 0.20% NA
Japonica Intermediate  241 81.30% 7.50% 9.96% 1.24% NA
VI/Aromatic  96 10.40% 28.10% 58.33% 3.12% NA
Intermediate  90 51.10% 22.20% 26.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0712954506 T -> DEL N N silent_mutation Average:21.218; most accessible tissue: Zhenshan97 flag leaf, score: 33.231 N N N N
vg0712954506 T -> C LOC_Os07g22960.1 upstream_gene_variant ; 4423.0bp to feature; MODIFIER silent_mutation Average:21.218; most accessible tissue: Zhenshan97 flag leaf, score: 33.231 N N N N
vg0712954506 T -> C LOC_Os07g22970.1 intron_variant ; MODIFIER silent_mutation Average:21.218; most accessible tissue: Zhenshan97 flag leaf, score: 33.231 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0712954506 NA 3.29E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0712954506 9.98E-06 8.43E-10 mr1524 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712954506 NA 1.02E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712954506 NA 1.18E-09 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712954506 NA 8.83E-12 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251