\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712740849:

Variant ID: vg0712740849 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 12740849
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATCGCCGCCACATCCCGTTCCGCCACCTCCCCTCTCCCGCCAAATCTAGCGGAGGGGAGGGAGCCGCCGCCACTTCCCGAGCCGCTGAGCCGCCGCCA[G/A]
GCCGCTGCCGCCGCTGCATCCCCTTCCGCCGTCGGGCCGCCACTGTGTGGTGGAGAGAGAGAGAGAGCTGAGAGAGGGGAGGAGACAGAGAAGAGGGGCT

Reverse complement sequence

AGCCCCTCTTCTCTGTCTCCTCCCCTCTCTCAGCTCTCTCTCTCTCTCCACCACACAGTGGCGGCCCGACGGCGGAAGGGGATGCAGCGGCGGCAGCGGC[C/T]
TGGCGGCGGCTCAGCGGCTCGGGAAGTGGCGGCGGCTCCCTCCCCTCCGCTAGATTTGGCGGGAGAGGGGAGGTGGCGGAACGGGATGTGGCGGCGATGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.80% 25.90% 4.38% 4.95% NA
All Indica  2759 97.00% 0.90% 0.98% 1.12% NA
All Japonica  1512 6.50% 74.20% 9.26% 10.05% NA
Aus  269 79.60% 15.60% 2.60% 2.23% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.00% 2.80% 0.22% 0.00% NA
Indica III  913 99.60% 0.20% 0.22% 0.00% NA
Indica Intermediate  786 91.90% 1.10% 3.05% 3.94% NA
Temperate Japonica  767 2.00% 65.60% 15.12% 17.34% NA
Tropical Japonica  504 13.90% 85.30% 0.20% 0.60% NA
Japonica Intermediate  241 5.40% 78.40% 9.54% 6.64% NA
VI/Aromatic  96 22.90% 2.10% 30.21% 44.79% NA
Intermediate  90 57.80% 35.60% 4.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0712740849 G -> DEL N N silent_mutation Average:80.085; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N
vg0712740849 G -> A LOC_Os07g22620.1 upstream_gene_variant ; 4222.0bp to feature; MODIFIER silent_mutation Average:80.085; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N
vg0712740849 G -> A LOC_Os07g22620-LOC_Os07g22640 intergenic_region ; MODIFIER silent_mutation Average:80.085; most accessible tissue: Zhenshan97 young leaf, score: 89.875 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0712740849 G A -0.02 -0.02 -0.02 -0.03 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0712740849 NA 1.53E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712740849 NA 1.74E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712740849 NA 4.32E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712740849 NA 4.52E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712740849 NA 6.00E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712740849 NA 8.44E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712740849 NA 1.78E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712740849 NA 8.27E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712740849 1.23E-06 8.60E-06 mr1829_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712740849 3.43E-08 3.10E-07 mr1842_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251