Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0712116232:

Variant ID: vg0712116232 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 12116232
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTTGGTGCTTTTTGATCTTTTTCTTTCCGGACAAAAACATCGCACCCACATGGGCCAATATATGCCAATATTGGCATTAACTGACAAAACACCACCGC[G/T]
CGAATCACGAAGTGAGTTTTTACCACAAAGGCATCCAATACACTCCAATATGTCCAAAAATCCTGTTTTTGCGTTTTTTGAACTTTTTCATTTCGGTCAA

Reverse complement sequence

TTGACCGAAATGAAAAAGTTCAAAAAACGCAAAAACAGGATTTTTGGACATATTGGAGTGTATTGGATGCCTTTGTGGTAAAAACTCACTTCGTGATTCG[C/A]
GCGGTGGTGTTTTGTCAGTTAATGCCAATATTGGCATATATTGGCCCATGTGGGTGCGATGTTTTTGTCCGGAAAGAAAAAGATCAAAAAGCACCAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.90%	37.50%	6.92%	5.76%	NA
All Indica	2759	77.20%	7.00%	8.66%	7.10%	NA
All Japonica	1512	2.20%	91.60%	3.04%	3.17%	NA
Aus	269	51.30%	34.20%	13.38%	1.12%	NA
Indica I	595	88.60%	3.00%	5.04%	3.36%	NA
Indica II	465	75.10%	7.70%	10.32%	6.88%	NA
Indica III	913	73.70%	5.50%	8.87%	11.94%	NA
Indica Intermediate	786	74.00%	11.30%	10.18%	4.45%	NA
Temperate Japonica	767	2.50%	88.00%	5.48%	4.04%	NA
Tropical Japonica	504	0.80%	99.00%	0.00%	0.20%	NA
Japonica Intermediate	241	4.10%	87.60%	1.66%	6.64%	NA
VI/Aromatic	96	19.80%	53.10%	4.17%	22.92%	NA
Intermediate	90	40.00%	54.40%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0712116232	G -> DEL	N	N	silent_mutation	Average:30.187; most accessible tissue: Minghui63 flag leaf, score: 41.254	N	N	N	N
vg0712116232	G -> T	LOC_Os07g20950.1	upstream_gene_variant ; 1546.0bp to feature; MODIFIER	silent_mutation	Average:30.187; most accessible tissue: Minghui63 flag leaf, score: 41.254	N	N	N	N
vg0712116232	G -> T	LOC_Os07g20940.1	downstream_gene_variant ; 2560.0bp to feature; MODIFIER	silent_mutation	Average:30.187; most accessible tissue: Minghui63 flag leaf, score: 41.254	N	N	N	N
vg0712116232	G -> T	LOC_Os07g20940-LOC_Os07g20950	intergenic_region ; MODIFIER	silent_mutation	Average:30.187; most accessible tissue: Minghui63 flag leaf, score: 41.254	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0712116232	NA	5.59E-07	mr1134	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712116232	NA	9.12E-06	mr1135	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712116232	NA	2.14E-08	mr1504	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712116232	NA	1.28E-58	mr1962	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712116232	NA	7.31E-06	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712116232	NA	7.93E-06	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712116232	NA	5.94E-06	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251