Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0712030137:

Variant ID: vg0712030137 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 12030137
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAACTAGTGGGCACTCTACTCAAGGTTCCCCTAGTATGAATTTAGGTAGATGCTTCGCTGGTTAATTAGGCAACATTAGGTGGTTCTACAACTCTAGAC[A/T]
TTGGGAATATTCTCATCACTTGGACACTATGGAATGGTTGGATTATTGTGGAAATTGGATTCACACCTCCACCTCTATTCAAAACCCCCAAAATGGTTTT

Reverse complement sequence

AAAACCATTTTGGGGGTTTTGAATAGAGGTGGAGGTGTGAATCCAATTTCCACAATAATCCAACCATTCCATAGTGTCCAAGTGATGAGAATATTCCCAA[T/A]
GTCTAGAGTTGTAGAACCACCTAATGTTGCCTAATTAACCAGCGAAGCATCTACCTAAATTCATACTAGGGGAACCTTGAGTAGAGTGCCCACTAGTTGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.60%	14.10%	0.59%	19.72%	NA
All Indica	2759	96.20%	1.30%	0.54%	1.92%	NA
All Japonica	1512	11.20%	38.80%	0.20%	49.80%	NA
Aus	269	71.70%	8.20%	3.35%	16.73%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	95.70%	3.20%	0.00%	1.08%	NA
Indica III	913	98.20%	0.00%	1.31%	0.44%	NA
Indica Intermediate	786	91.20%	2.80%	0.38%	5.60%	NA
Temperate Japonica	767	7.40%	51.60%	0.00%	40.94%	NA
Tropical Japonica	504	17.10%	23.20%	0.60%	59.13%	NA
Japonica Intermediate	241	11.20%	30.30%	0.00%	58.51%	NA
VI/Aromatic	96	26.00%	3.10%	1.04%	69.79%	NA
Intermediate	90	64.40%	20.00%	0.00%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0712030137	A -> DEL	N	N	silent_mutation	Average:44.358; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0712030137	A -> T	LOC_Os07g20790.1	upstream_gene_variant ; 881.0bp to feature; MODIFIER	silent_mutation	Average:44.358; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0712030137	A -> T	LOC_Os07g20800.1	upstream_gene_variant ; 1859.0bp to feature; MODIFIER	silent_mutation	Average:44.358; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0712030137	A -> T	LOC_Os07g20810.1	upstream_gene_variant ; 4877.0bp to feature; MODIFIER	silent_mutation	Average:44.358; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0712030137	A -> T	LOC_Os07g20790-LOC_Os07g20800	intergenic_region ; MODIFIER	silent_mutation	Average:44.358; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0712030137	1.79E-06	NA	mr1602	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712030137	NA	5.62E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251