\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0712030137:

Variant ID: vg0712030137 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 12030137
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAACTAGTGGGCACTCTACTCAAGGTTCCCCTAGTATGAATTTAGGTAGATGCTTCGCTGGTTAATTAGGCAACATTAGGTGGTTCTACAACTCTAGAC[A/T]
TTGGGAATATTCTCATCACTTGGACACTATGGAATGGTTGGATTATTGTGGAAATTGGATTCACACCTCCACCTCTATTCAAAACCCCCAAAATGGTTTT

Reverse complement sequence

AAAACCATTTTGGGGGTTTTGAATAGAGGTGGAGGTGTGAATCCAATTTCCACAATAATCCAACCATTCCATAGTGTCCAAGTGATGAGAATATTCCCAA[T/A]
GTCTAGAGTTGTAGAACCACCTAATGTTGCCTAATTAACCAGCGAAGCATCTACCTAAATTCATACTAGGGGAACCTTGAGTAGAGTGCCCACTAGTTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 14.10% 0.59% 19.72% NA
All Indica  2759 96.20% 1.30% 0.54% 1.92% NA
All Japonica  1512 11.20% 38.80% 0.20% 49.80% NA
Aus  269 71.70% 8.20% 3.35% 16.73% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.70% 3.20% 0.00% 1.08% NA
Indica III  913 98.20% 0.00% 1.31% 0.44% NA
Indica Intermediate  786 91.20% 2.80% 0.38% 5.60% NA
Temperate Japonica  767 7.40% 51.60% 0.00% 40.94% NA
Tropical Japonica  504 17.10% 23.20% 0.60% 59.13% NA
Japonica Intermediate  241 11.20% 30.30% 0.00% 58.51% NA
VI/Aromatic  96 26.00% 3.10% 1.04% 69.79% NA
Intermediate  90 64.40% 20.00% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0712030137 A -> DEL N N silent_mutation Average:44.358; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg0712030137 A -> T LOC_Os07g20790.1 upstream_gene_variant ; 881.0bp to feature; MODIFIER silent_mutation Average:44.358; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg0712030137 A -> T LOC_Os07g20800.1 upstream_gene_variant ; 1859.0bp to feature; MODIFIER silent_mutation Average:44.358; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg0712030137 A -> T LOC_Os07g20810.1 upstream_gene_variant ; 4877.0bp to feature; MODIFIER silent_mutation Average:44.358; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg0712030137 A -> T LOC_Os07g20790-LOC_Os07g20800 intergenic_region ; MODIFIER silent_mutation Average:44.358; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0712030137 1.79E-06 NA mr1602 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0712030137 NA 5.62E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251