Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711698103:

Variant ID: vg0711698103 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 11698103
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGCTCAAAACTAATGTTTGGCGATGGGAAAAAAAATGGCGTGGCTATATAGTAGCGATGGGTAGATGAAATATAATTGCAAACTAAAATCCTTACCAGG[C/T]
AACTGATACTCTGATACCAACTGATGACGCTCTCTCTCGTGGCCCGATATTCTGGTGAGGGGGATAACTCTCGCTTTGATCGAGTGCGACGTTTTCGATG

Reverse complement sequence

CATCGAAAACGTCGCACTCGATCAAAGCGAGAGTTATCCCCCTCACCAGAATATCGGGCCACGAGAGAGAGCGTCATCAGTTGGTATCAGAGTATCAGTT[G/A]
CCTGGTAAGGATTTTAGTTTGCAATTATATTTCATCTACCCATCGCTACTATATAGCCACGCCATTTTTTTTCCCATCGCCAAACATTAGTTTTGAGCCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.40%	26.40%	0.15%	15.07%	NA
All Indica	2759	86.00%	1.50%	0.04%	12.43%	NA
All Japonica	1512	6.50%	74.60%	0.26%	18.65%	NA
Aus	269	79.60%	15.60%	0.00%	4.83%	NA
Indica I	595	69.20%	1.70%	0.00%	29.08%	NA
Indica II	465	91.80%	3.20%	0.00%	4.95%	NA
Indica III	913	99.50%	0.10%	0.00%	0.44%	NA
Indica Intermediate	786	79.60%	2.00%	0.13%	18.19%	NA
Temperate Japonica	767	2.20%	66.00%	0.52%	31.29%	NA
Tropical Japonica	504	13.70%	85.70%	0.00%	0.60%	NA
Japonica Intermediate	241	5.00%	78.80%	0.00%	16.18%	NA
VI/Aromatic	96	27.10%	1.00%	2.08%	69.79%	NA
Intermediate	90	53.30%	38.90%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0711698103	C -> DEL	N	N	silent_mutation	Average:53.844; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0711698103	C -> T	LOC_Os07g20280.1	upstream_gene_variant ; 1187.0bp to feature; MODIFIER	silent_mutation	Average:53.844; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0711698103	C -> T	LOC_Os07g20280-LOC_Os07g20290	intergenic_region ; MODIFIER	silent_mutation	Average:53.844; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0711698103	3.54E-06	7.38E-09	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	4.63E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	4.68E-24	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	9.18E-20	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	7.71E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	5.98E-09	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	2.78E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	1.81E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	1.70E-06	NA	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	3.37E-06	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	2.12E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	2.80E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	2.30E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	1.43E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	2.15E-07	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	1.08E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	1.49E-16	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	1.70E-06	2.19E-07	mr1585_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	7.09E-13	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	1.08E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	8.23E-11	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	3.11E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	2.25E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	2.18E-11	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	7.00E-15	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	2.27E-10	mr1765_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	3.13E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	2.93E-16	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	1.54E-19	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	2.16E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103	NA	3.33E-12	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251