\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711698103:

Variant ID: vg0711698103 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 11698103
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGCTCAAAACTAATGTTTGGCGATGGGAAAAAAAATGGCGTGGCTATATAGTAGCGATGGGTAGATGAAATATAATTGCAAACTAAAATCCTTACCAGG[C/T]
AACTGATACTCTGATACCAACTGATGACGCTCTCTCTCGTGGCCCGATATTCTGGTGAGGGGGATAACTCTCGCTTTGATCGAGTGCGACGTTTTCGATG

Reverse complement sequence

CATCGAAAACGTCGCACTCGATCAAAGCGAGAGTTATCCCCCTCACCAGAATATCGGGCCACGAGAGAGAGCGTCATCAGTTGGTATCAGAGTATCAGTT[G/A]
CCTGGTAAGGATTTTAGTTTGCAATTATATTTCATCTACCCATCGCTACTATATAGCCACGCCATTTTTTTTCCCATCGCCAAACATTAGTTTTGAGCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 26.40% 0.15% 15.07% NA
All Indica  2759 86.00% 1.50% 0.04% 12.43% NA
All Japonica  1512 6.50% 74.60% 0.26% 18.65% NA
Aus  269 79.60% 15.60% 0.00% 4.83% NA
Indica I  595 69.20% 1.70% 0.00% 29.08% NA
Indica II  465 91.80% 3.20% 0.00% 4.95% NA
Indica III  913 99.50% 0.10% 0.00% 0.44% NA
Indica Intermediate  786 79.60% 2.00% 0.13% 18.19% NA
Temperate Japonica  767 2.20% 66.00% 0.52% 31.29% NA
Tropical Japonica  504 13.70% 85.70% 0.00% 0.60% NA
Japonica Intermediate  241 5.00% 78.80% 0.00% 16.18% NA
VI/Aromatic  96 27.10% 1.00% 2.08% 69.79% NA
Intermediate  90 53.30% 38.90% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0711698103 C -> DEL N N silent_mutation Average:53.844; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0711698103 C -> T LOC_Os07g20280.1 upstream_gene_variant ; 1187.0bp to feature; MODIFIER silent_mutation Average:53.844; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0711698103 C -> T LOC_Os07g20280-LOC_Os07g20290 intergenic_region ; MODIFIER silent_mutation Average:53.844; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0711698103 3.54E-06 7.38E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 4.63E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 4.68E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 9.18E-20 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 7.71E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 5.98E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 2.78E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 1.81E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 1.70E-06 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 3.37E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 2.12E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 2.80E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 2.30E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 1.43E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 2.15E-07 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 1.08E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 1.49E-16 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 1.70E-06 2.19E-07 mr1585_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 7.09E-13 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 1.08E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 8.23E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 3.11E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 2.25E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 2.18E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 7.00E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 2.27E-10 mr1765_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 3.13E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 2.93E-16 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 1.54E-19 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 2.16E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711698103 NA 3.33E-12 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251