\
| Variant ID: vg0711642430 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 11642430 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCTGTAATGACATTTTATTCGCTTATTATTTAGAGTAATAATTGTACTCTATTATCAATTTGTTATTGTGTACCTCGGTTGACTCCTGGACGAGGGTTT[C/A]
TACACATGTAAGCGTTTGGAATTTTGGATAGAAATTCCGGGCGTGACAAAAAATACCGAAGAAGGAAAAAAAAAATAACAATCAGAAATCACGATTCACA
TGTGAATCGTGATTTCTGATTGTTATTTTTTTTTTCCTTCTTCGGTATTTTTTGTCACGCCCGGAATTTCTATCCAAAATTCCAAACGCTTACATGTGTA[G/T]
AAACCCTCGTCCAGGAGTCAACCGAGGTACACAATAACAAATTGATAATAGAGTACAATTATTACTCTAAATAATAAGCGAATAAAATGTCATTACAGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.90% | 0.40% | 7.51% | 30.15% | NA |
| All Indica | 2759 | 56.00% | 0.70% | 9.97% | 33.42% | NA |
| All Japonica | 1512 | 78.00% | 0.00% | 1.19% | 20.77% | NA |
| Aus | 269 | 40.50% | 0.00% | 15.24% | 44.24% | NA |
| Indica I | 595 | 31.10% | 0.30% | 11.43% | 57.14% | NA |
| Indica II | 465 | 55.30% | 0.90% | 12.69% | 31.18% | NA |
| Indica III | 913 | 71.60% | 1.00% | 7.56% | 19.82% | NA |
| Indica Intermediate | 786 | 57.00% | 0.40% | 10.05% | 32.57% | NA |
| Temperate Japonica | 767 | 69.10% | 0.00% | 1.30% | 29.60% | NA |
| Tropical Japonica | 504 | 89.10% | 0.00% | 1.19% | 9.72% | NA |
| Japonica Intermediate | 241 | 83.40% | 0.00% | 0.83% | 15.77% | NA |
| VI/Aromatic | 96 | 37.50% | 0.00% | 10.42% | 52.08% | NA |
| Intermediate | 90 | 64.40% | 1.10% | 12.22% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0711642430 | C -> DEL | N | N | silent_mutation | Average:35.035; most accessible tissue: Callus, score: 94.291 | N | N | N | N |
| vg0711642430 | C -> A | LOC_Os07g20160.1 | upstream_gene_variant ; 4494.0bp to feature; MODIFIER | silent_mutation | Average:35.035; most accessible tissue: Callus, score: 94.291 | N | N | N | N |
| vg0711642430 | C -> A | LOC_Os07g20164.1 | upstream_gene_variant ; 122.0bp to feature; MODIFIER | silent_mutation | Average:35.035; most accessible tissue: Callus, score: 94.291 | N | N | N | N |
| vg0711642430 | C -> A | LOC_Os07g20180.1 | upstream_gene_variant ; 4991.0bp to feature; MODIFIER | silent_mutation | Average:35.035; most accessible tissue: Callus, score: 94.291 | N | N | N | N |
| vg0711642430 | C -> A | LOC_Os07g20170.1 | downstream_gene_variant ; 2145.0bp to feature; MODIFIER | silent_mutation | Average:35.035; most accessible tissue: Callus, score: 94.291 | N | N | N | N |
| vg0711642430 | C -> A | LOC_Os07g20160-LOC_Os07g20164 | intergenic_region ; MODIFIER | silent_mutation | Average:35.035; most accessible tissue: Callus, score: 94.291 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0711642430 | NA | 1.99E-07 | mr1354 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 1.26E-09 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 6.08E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 1.38E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 4.77E-10 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 3.45E-08 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 6.76E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 5.20E-07 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 8.33E-08 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 3.74E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 4.53E-07 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 3.80E-06 | mr1516_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | 9.68E-06 | 9.63E-06 | mr1523_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 3.19E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 8.64E-10 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | 6.78E-06 | 2.39E-12 | mr1751_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 2.14E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 4.40E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711642430 | NA | 6.73E-12 | mr1986_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |