\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711642430:

Variant ID: vg0711642430 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 11642430
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCTGTAATGACATTTTATTCGCTTATTATTTAGAGTAATAATTGTACTCTATTATCAATTTGTTATTGTGTACCTCGGTTGACTCCTGGACGAGGGTTT[C/A]
TACACATGTAAGCGTTTGGAATTTTGGATAGAAATTCCGGGCGTGACAAAAAATACCGAAGAAGGAAAAAAAAAATAACAATCAGAAATCACGATTCACA

Reverse complement sequence

TGTGAATCGTGATTTCTGATTGTTATTTTTTTTTTCCTTCTTCGGTATTTTTTGTCACGCCCGGAATTTCTATCCAAAATTCCAAACGCTTACATGTGTA[G/T]
AAACCCTCGTCCAGGAGTCAACCGAGGTACACAATAACAAATTGATAATAGAGTACAATTATTACTCTAAATAATAAGCGAATAAAATGTCATTACAGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.90% 0.40% 7.51% 30.15% NA
All Indica  2759 56.00% 0.70% 9.97% 33.42% NA
All Japonica  1512 78.00% 0.00% 1.19% 20.77% NA
Aus  269 40.50% 0.00% 15.24% 44.24% NA
Indica I  595 31.10% 0.30% 11.43% 57.14% NA
Indica II  465 55.30% 0.90% 12.69% 31.18% NA
Indica III  913 71.60% 1.00% 7.56% 19.82% NA
Indica Intermediate  786 57.00% 0.40% 10.05% 32.57% NA
Temperate Japonica  767 69.10% 0.00% 1.30% 29.60% NA
Tropical Japonica  504 89.10% 0.00% 1.19% 9.72% NA
Japonica Intermediate  241 83.40% 0.00% 0.83% 15.77% NA
VI/Aromatic  96 37.50% 0.00% 10.42% 52.08% NA
Intermediate  90 64.40% 1.10% 12.22% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0711642430 C -> DEL N N silent_mutation Average:35.035; most accessible tissue: Callus, score: 94.291 N N N N
vg0711642430 C -> A LOC_Os07g20160.1 upstream_gene_variant ; 4494.0bp to feature; MODIFIER silent_mutation Average:35.035; most accessible tissue: Callus, score: 94.291 N N N N
vg0711642430 C -> A LOC_Os07g20164.1 upstream_gene_variant ; 122.0bp to feature; MODIFIER silent_mutation Average:35.035; most accessible tissue: Callus, score: 94.291 N N N N
vg0711642430 C -> A LOC_Os07g20180.1 upstream_gene_variant ; 4991.0bp to feature; MODIFIER silent_mutation Average:35.035; most accessible tissue: Callus, score: 94.291 N N N N
vg0711642430 C -> A LOC_Os07g20170.1 downstream_gene_variant ; 2145.0bp to feature; MODIFIER silent_mutation Average:35.035; most accessible tissue: Callus, score: 94.291 N N N N
vg0711642430 C -> A LOC_Os07g20160-LOC_Os07g20164 intergenic_region ; MODIFIER silent_mutation Average:35.035; most accessible tissue: Callus, score: 94.291 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0711642430 NA 1.99E-07 mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 1.26E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 6.08E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 1.38E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 4.77E-10 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 3.45E-08 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 6.76E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 5.20E-07 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 8.33E-08 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 3.74E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 4.53E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 3.80E-06 mr1516_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 9.68E-06 9.63E-06 mr1523_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 3.19E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 8.64E-10 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 6.78E-06 2.39E-12 mr1751_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 2.14E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 4.40E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430 NA 6.73E-12 mr1986_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251