Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0711642430:

Variant ID: vg0711642430 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 11642430
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCTGTAATGACATTTTATTCGCTTATTATTTAGAGTAATAATTGTACTCTATTATCAATTTGTTATTGTGTACCTCGGTTGACTCCTGGACGAGGGTTT[C/A]
TACACATGTAAGCGTTTGGAATTTTGGATAGAAATTCCGGGCGTGACAAAAAATACCGAAGAAGGAAAAAAAAAATAACAATCAGAAATCACGATTCACA

Reverse complement sequence

TGTGAATCGTGATTTCTGATTGTTATTTTTTTTTTCCTTCTTCGGTATTTTTTGTCACGCCCGGAATTTCTATCCAAAATTCCAAACGCTTACATGTGTA[G/T]
AAACCCTCGTCCAGGAGTCAACCGAGGTACACAATAACAAATTGATAATAGAGTACAATTATTACTCTAAATAATAAGCGAATAAAATGTCATTACAGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.90%	0.40%	7.51%	30.15%	NA
All Indica	2759	56.00%	0.70%	9.97%	33.42%	NA
All Japonica	1512	78.00%	0.00%	1.19%	20.77%	NA
Aus	269	40.50%	0.00%	15.24%	44.24%	NA
Indica I	595	31.10%	0.30%	11.43%	57.14%	NA
Indica II	465	55.30%	0.90%	12.69%	31.18%	NA
Indica III	913	71.60%	1.00%	7.56%	19.82%	NA
Indica Intermediate	786	57.00%	0.40%	10.05%	32.57%	NA
Temperate Japonica	767	69.10%	0.00%	1.30%	29.60%	NA
Tropical Japonica	504	89.10%	0.00%	1.19%	9.72%	NA
Japonica Intermediate	241	83.40%	0.00%	0.83%	15.77%	NA
VI/Aromatic	96	37.50%	0.00%	10.42%	52.08%	NA
Intermediate	90	64.40%	1.10%	12.22%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0711642430	C -> DEL	N	N	silent_mutation	Average:35.035; most accessible tissue: Callus, score: 94.291	N	N	N	N
vg0711642430	C -> A	LOC_Os07g20160.1	upstream_gene_variant ; 4494.0bp to feature; MODIFIER	silent_mutation	Average:35.035; most accessible tissue: Callus, score: 94.291	N	N	N	N
vg0711642430	C -> A	LOC_Os07g20164.1	upstream_gene_variant ; 122.0bp to feature; MODIFIER	silent_mutation	Average:35.035; most accessible tissue: Callus, score: 94.291	N	N	N	N
vg0711642430	C -> A	LOC_Os07g20180.1	upstream_gene_variant ; 4991.0bp to feature; MODIFIER	silent_mutation	Average:35.035; most accessible tissue: Callus, score: 94.291	N	N	N	N
vg0711642430	C -> A	LOC_Os07g20170.1	downstream_gene_variant ; 2145.0bp to feature; MODIFIER	silent_mutation	Average:35.035; most accessible tissue: Callus, score: 94.291	N	N	N	N
vg0711642430	C -> A	LOC_Os07g20160-LOC_Os07g20164	intergenic_region ; MODIFIER	silent_mutation	Average:35.035; most accessible tissue: Callus, score: 94.291	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0711642430	NA	1.99E-07	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	1.26E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	6.08E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	1.38E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	4.77E-10	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	3.45E-08	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	6.76E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	5.20E-07	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	8.33E-08	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	3.74E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	4.53E-07	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	3.80E-06	mr1516_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	9.68E-06	9.63E-06	mr1523_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	3.19E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	8.64E-10	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	6.78E-06	2.39E-12	mr1751_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	2.14E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	4.40E-13	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711642430	NA	6.73E-12	mr1986_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251