\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711597576:

Variant ID: vg0711597576 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 11597576
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCCGACCTCCATCCATCCCGGCCGGCATCGCAACCGTCGTGGCCACCAAATCCCCCCACCCCATGTCGACGGCTCCCTCGCGCCCTCCTGTGCGGGCC[C/A]
GATGCCGACCCCTCCACTCTCCTCTCTACTTCCCCTGCAAGAACCGGCGCCGAATAGCCGCCCACCTCCTCCACAATGCCACCCCTCTCTCTCTCTTTTC

Reverse complement sequence

GAAAAGAGAGAGAGAGGGGTGGCATTGTGGAGGAGGTGGGCGGCTATTCGGCGCCGGTTCTTGCAGGGGAAGTAGAGAGGAGAGTGGAGGGGTCGGCATC[G/T]
GGCCCGCACAGGAGGGCGCGAGGGAGCCGTCGACATGGGGTGGGGGGATTTGGTGGCCACGACGGTTGCGATGCCGGCCGGGATGGATGGAGGTCGGGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 5.50% 0.02% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 87.60% 12.30% 0.07% 0.00% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 80.80% 19.20% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 84.60% 14.90% 0.41% 0.00% NA
VI/Aromatic  96 42.70% 57.30% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0711597576 C -> A LOC_Os07g19560.1 upstream_gene_variant ; 711.0bp to feature; MODIFIER silent_mutation Average:86.154; most accessible tissue: Minghui63 panicle, score: 93.176 N N N N
vg0711597576 C -> A LOC_Os07g19560.2 upstream_gene_variant ; 741.0bp to feature; MODIFIER silent_mutation Average:86.154; most accessible tissue: Minghui63 panicle, score: 93.176 N N N N
vg0711597576 C -> A LOC_Os07g19570.1 downstream_gene_variant ; 252.0bp to feature; MODIFIER silent_mutation Average:86.154; most accessible tissue: Minghui63 panicle, score: 93.176 N N N N
vg0711597576 C -> A LOC_Os07g19580.1 downstream_gene_variant ; 1700.0bp to feature; MODIFIER silent_mutation Average:86.154; most accessible tissue: Minghui63 panicle, score: 93.176 N N N N
vg0711597576 C -> A LOC_Os07g19560-LOC_Os07g19570 intergenic_region ; MODIFIER silent_mutation Average:86.154; most accessible tissue: Minghui63 panicle, score: 93.176 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0711597576 C A 0.01 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0711597576 1.67E-06 1.25E-36 Awn_length All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0711597576 NA 5.50E-11 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0711597576 NA 7.50E-06 mr1006 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711597576 NA 4.27E-06 mr1052 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711597576 NA 3.10E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711597576 NA 6.88E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711597576 NA 7.74E-09 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711597576 NA 4.48E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711597576 NA 5.87E-12 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251