\
| Variant ID: vg0711410816 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 11410816 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 204. )
GTTGAAATAAATAGAGAATTTAAATATAGGATCAACATGCTCAAAGGAATTGTGTTTGGGATCTGTGTGACTTGCCTTGCAATAACGGGTCTTCAATTAA[C/T]
CTTCTTGAACACTTCCGAGGCACTTACGATCCTTCGAAACGACGGAAACGACAAGCTAACACGCAAAACGAGAAAAAAGACTAATAAAAACCAAATAAAC
GTTTATTTGGTTTTTATTAGTCTTTTTTCTCGTTTTGCGTGTTAGCTTGTCGTTTCCGTCGTTTCGAAGGATCGTAAGTGCCTCGGAAGTGTTCAAGAAG[G/A]
TTAATTGAAGACCCGTTATTGCAAGGCAAGTCACACAGATCCCAAACACAATTCCTTTGAGCATGTTGATCCTATATTTAAATTCTCTATTTATTTCAAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.80% | 27.00% | 13.50% | 18.71% | NA |
| All Indica | 2759 | 50.00% | 4.00% | 15.80% | 30.23% | NA |
| All Japonica | 1512 | 19.80% | 74.40% | 5.09% | 0.66% | NA |
| Aus | 269 | 52.40% | 3.00% | 35.69% | 8.92% | NA |
| Indica I | 595 | 40.50% | 4.70% | 7.56% | 47.23% | NA |
| Indica II | 465 | 21.30% | 6.70% | 16.13% | 55.91% | NA |
| Indica III | 913 | 69.40% | 1.00% | 19.72% | 9.86% | NA |
| Indica Intermediate | 786 | 51.70% | 5.20% | 17.30% | 25.83% | NA |
| Temperate Japonica | 767 | 33.10% | 65.30% | 0.52% | 1.04% | NA |
| Tropical Japonica | 504 | 1.00% | 85.90% | 13.10% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.00% | 79.30% | 2.90% | 0.83% | NA |
| VI/Aromatic | 96 | 84.40% | 0.00% | 14.58% | 1.04% | NA |
| Intermediate | 90 | 28.90% | 37.80% | 16.67% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0711410816 | C -> DEL | N | N | silent_mutation | Average:6.803; most accessible tissue: Callus, score: 11.104 | N | N | N | N |
| vg0711410816 | C -> T | LOC_Os07g19274.1 | downstream_gene_variant ; 913.0bp to feature; MODIFIER | silent_mutation | Average:6.803; most accessible tissue: Callus, score: 11.104 | N | N | N | N |
| vg0711410816 | C -> T | LOC_Os07g19274-LOC_Os07g19290 | intergenic_region ; MODIFIER | silent_mutation | Average:6.803; most accessible tissue: Callus, score: 11.104 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0711410816 | NA | 7.86E-08 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0711410816 | NA | 3.58E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711410816 | NA | 1.61E-08 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711410816 | NA | 3.66E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711410816 | NA | 1.15E-06 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711410816 | NA | 2.07E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711410816 | NA | 1.89E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711410816 | NA | 1.47E-06 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711410816 | NA | 6.49E-10 | mr1479_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711410816 | NA | 2.23E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711410816 | NA | 1.41E-07 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711410816 | NA | 7.45E-16 | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711410816 | NA | 3.66E-06 | mr1726_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711410816 | NA | 6.93E-06 | mr1741_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711410816 | NA | 9.65E-09 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |