\
| Variant ID: vg0711201796 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 11201796 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGACTGGGCCAACTCCCAATCGGCTTATTCTTTGCCGACAAGATCCAGTGTCGAGGAGAAATCACATCAACTCTGATGATGGATCGGCTGCTTAACCTCC[C/A,T]
AGGACCCCCTCTGGGCAACATTGACAATATTGAGTTGGCAGGATTCAAGAGCAGAAACTTCGACAGATGGTGGGGTGAATGGAAGCTGCACATGTTTCAT
ATGAAACATGTGCAGCTTCCATTCACCCCACCATCTGTCGAAGTTTCTGCTCTTGAATCCTGCCAACTCAATATTGTCAATGTTGCCCAGAGGGGGTCCT[G/T,A]
GGAGGTTAAGCAGCCGATCCATCATCAGAGTTGATGTGATTTCTCCTCGACACTGGATCTTGTCGGCAAAGAATAAGCCGATTGGGAGTTGGCCCAGTCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.70% | 3.30% | 2.33% | 2.96% | T: 2.71% |
| All Indica | 2759 | 93.70% | 3.20% | 2.90% | 0.04% | T: 0.18% |
| All Japonica | 1512 | 86.70% | 3.40% | 0.73% | 9.13% | NA |
| Aus | 269 | 46.50% | 4.10% | 5.95% | 0.00% | T: 43.49% |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 94.00% | 2.40% | 3.44% | 0.00% | T: 0.22% |
| Indica III | 913 | 90.70% | 5.70% | 3.61% | 0.00% | NA |
| Indica Intermediate | 786 | 92.50% | 3.10% | 3.82% | 0.13% | T: 0.51% |
| Temperate Japonica | 767 | 76.40% | 6.50% | 1.30% | 15.78% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 92.90% | 0.40% | 0.41% | 6.22% | NA |
| VI/Aromatic | 96 | 88.50% | 4.20% | 3.12% | 1.04% | T: 3.12% |
| Intermediate | 90 | 94.40% | 2.20% | 0.00% | 0.00% | T: 3.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0711201796 | C -> DEL | N | N | silent_mutation | Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0711201796 | C -> A | LOC_Os07g18890.1 | upstream_gene_variant ; 4623.0bp to feature; MODIFIER | silent_mutation | Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0711201796 | C -> A | LOC_Os07g18910.1 | downstream_gene_variant ; 2117.0bp to feature; MODIFIER | silent_mutation | Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0711201796 | C -> A | LOC_Os07g18920.1 | downstream_gene_variant ; 3646.0bp to feature; MODIFIER | silent_mutation | Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0711201796 | C -> A | LOC_Os07g18900.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0711201796 | C -> T | LOC_Os07g18890.1 | upstream_gene_variant ; 4623.0bp to feature; MODIFIER | silent_mutation | Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0711201796 | C -> T | LOC_Os07g18910.1 | downstream_gene_variant ; 2117.0bp to feature; MODIFIER | silent_mutation | Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0711201796 | C -> T | LOC_Os07g18920.1 | downstream_gene_variant ; 3646.0bp to feature; MODIFIER | silent_mutation | Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0711201796 | C -> T | LOC_Os07g18900.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0711201796 | 1.03E-06 | 1.03E-06 | mr1237 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711201796 | 1.66E-06 | 1.66E-06 | mr1973 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711201796 | NA | 6.12E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711201796 | 6.47E-06 | 9.30E-06 | mr1502_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711201796 | 3.92E-06 | 3.92E-06 | mr1643_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0711201796 | 7.15E-06 | 5.01E-06 | mr1849_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |