\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0711201796:

Variant ID: vg0711201796 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 11201796
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGACTGGGCCAACTCCCAATCGGCTTATTCTTTGCCGACAAGATCCAGTGTCGAGGAGAAATCACATCAACTCTGATGATGGATCGGCTGCTTAACCTCC[C/A,T]
AGGACCCCCTCTGGGCAACATTGACAATATTGAGTTGGCAGGATTCAAGAGCAGAAACTTCGACAGATGGTGGGGTGAATGGAAGCTGCACATGTTTCAT

Reverse complement sequence

ATGAAACATGTGCAGCTTCCATTCACCCCACCATCTGTCGAAGTTTCTGCTCTTGAATCCTGCCAACTCAATATTGTCAATGTTGCCCAGAGGGGGTCCT[G/T,A]
GGAGGTTAAGCAGCCGATCCATCATCAGAGTTGATGTGATTTCTCCTCGACACTGGATCTTGTCGGCAAAGAATAAGCCGATTGGGAGTTGGCCCAGTCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 3.30% 2.33% 2.96% T: 2.71%
All Indica  2759 93.70% 3.20% 2.90% 0.04% T: 0.18%
All Japonica  1512 86.70% 3.40% 0.73% 9.13% NA
Aus  269 46.50% 4.10% 5.95% 0.00% T: 43.49%
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 94.00% 2.40% 3.44% 0.00% T: 0.22%
Indica III  913 90.70% 5.70% 3.61% 0.00% NA
Indica Intermediate  786 92.50% 3.10% 3.82% 0.13% T: 0.51%
Temperate Japonica  767 76.40% 6.50% 1.30% 15.78% NA
Tropical Japonica  504 99.40% 0.20% 0.00% 0.40% NA
Japonica Intermediate  241 92.90% 0.40% 0.41% 6.22% NA
VI/Aromatic  96 88.50% 4.20% 3.12% 1.04% T: 3.12%
Intermediate  90 94.40% 2.20% 0.00% 0.00% T: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0711201796 C -> DEL N N silent_mutation Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0711201796 C -> A LOC_Os07g18890.1 upstream_gene_variant ; 4623.0bp to feature; MODIFIER silent_mutation Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0711201796 C -> A LOC_Os07g18910.1 downstream_gene_variant ; 2117.0bp to feature; MODIFIER silent_mutation Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0711201796 C -> A LOC_Os07g18920.1 downstream_gene_variant ; 3646.0bp to feature; MODIFIER silent_mutation Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0711201796 C -> A LOC_Os07g18900.1 intron_variant ; MODIFIER silent_mutation Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0711201796 C -> T LOC_Os07g18890.1 upstream_gene_variant ; 4623.0bp to feature; MODIFIER silent_mutation Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0711201796 C -> T LOC_Os07g18910.1 downstream_gene_variant ; 2117.0bp to feature; MODIFIER silent_mutation Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0711201796 C -> T LOC_Os07g18920.1 downstream_gene_variant ; 3646.0bp to feature; MODIFIER silent_mutation Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0711201796 C -> T LOC_Os07g18900.1 intron_variant ; MODIFIER silent_mutation Average:20.089; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0711201796 1.03E-06 1.03E-06 mr1237 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711201796 1.66E-06 1.66E-06 mr1973 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711201796 NA 6.12E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711201796 6.47E-06 9.30E-06 mr1502_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711201796 3.92E-06 3.92E-06 mr1643_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0711201796 7.15E-06 5.01E-06 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251