Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0710830865:

Variant ID: vg0710830865 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10830865
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.77, G: 0.24, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

TCTAGGTAAAGAATAAATATTTTTGTGTGGCAATTTTCTGGTTATGGGAAGATAAATTACCTAACGGGCAACCACGCTCTGATACCAACTGATGAGGGAT[A/G]
TTAGGTCCCGATCTTCCGATAGGTATTGATAAACAACGATTTGGGCGGAGTCGCGACACAACTCGATCCGGCTTCTGAACAAACACGCTACTGAGCCCCG

Reverse complement sequence

CGGGGCTCAGTAGCGTGTTTGTTCAGAAGCCGGATCGAGTTGTGTCGCGACTCCGCCCAAATCGTTGTTTATCAATACCTATCGGAAGATCGGGACCTAA[T/C]
ATCCCTCATCAGTTGGTATCAGAGCGTGGTTGCCCGTTAGGTAATTTATCTTCCCATAACCAGAAAATTGCCACACAAAAATATTTATTCTTTACCTAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.80%	0.60%	1.88%	4.72%	NA
All Indica	2759	99.00%	0.10%	0.29%	0.65%	NA
All Japonica	1512	83.30%	0.90%	2.51%	13.23%	NA
Aus	269	98.10%	0.70%	1.12%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.40%	0.30%	1.02%	2.29%	NA
Temperate Japonica	767	72.60%	1.20%	3.26%	22.95%	NA
Tropical Japonica	504	99.40%	0.00%	0.20%	0.40%	NA
Japonica Intermediate	241	83.80%	2.10%	4.98%	9.13%	NA
VI/Aromatic	96	43.80%	9.40%	41.67%	5.21%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710830865	A -> DEL	N	N	silent_mutation	Average:35.233; most accessible tissue: Minghui63 flag leaf, score: 57.188	N	N	N	N
vg0710830865	A -> G	LOC_Os07g18270.1	upstream_gene_variant ; 1267.0bp to feature; MODIFIER	silent_mutation	Average:35.233; most accessible tissue: Minghui63 flag leaf, score: 57.188	N	N	N	N
vg0710830865	A -> G	LOC_Os07g18260.1	downstream_gene_variant ; 3863.0bp to feature; MODIFIER	silent_mutation	Average:35.233; most accessible tissue: Minghui63 flag leaf, score: 57.188	N	N	N	N
vg0710830865	A -> G	LOC_Os07g18280.1	downstream_gene_variant ; 3979.0bp to feature; MODIFIER	silent_mutation	Average:35.233; most accessible tissue: Minghui63 flag leaf, score: 57.188	N	N	N	N
vg0710830865	A -> G	LOC_Os07g18270-LOC_Os07g18280	intergenic_region ; MODIFIER	silent_mutation	Average:35.233; most accessible tissue: Minghui63 flag leaf, score: 57.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710830865	NA	6.16E-06	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710830865	5.97E-06	5.97E-06	mr1950	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710830865	NA	4.43E-06	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710830865	1.75E-06	1.34E-06	mr1203_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710830865	NA	5.05E-07	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710830865	4.11E-06	4.62E-08	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251