\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710830865:

Variant ID: vg0710830865 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10830865
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.77, G: 0.24, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TCTAGGTAAAGAATAAATATTTTTGTGTGGCAATTTTCTGGTTATGGGAAGATAAATTACCTAACGGGCAACCACGCTCTGATACCAACTGATGAGGGAT[A/G]
TTAGGTCCCGATCTTCCGATAGGTATTGATAAACAACGATTTGGGCGGAGTCGCGACACAACTCGATCCGGCTTCTGAACAAACACGCTACTGAGCCCCG

Reverse complement sequence

CGGGGCTCAGTAGCGTGTTTGTTCAGAAGCCGGATCGAGTTGTGTCGCGACTCCGCCCAAATCGTTGTTTATCAATACCTATCGGAAGATCGGGACCTAA[T/C]
ATCCCTCATCAGTTGGTATCAGAGCGTGGTTGCCCGTTAGGTAATTTATCTTCCCATAACCAGAAAATTGCCACACAAAAATATTTATTCTTTACCTAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 0.60% 1.88% 4.72% NA
All Indica  2759 99.00% 0.10% 0.29% 0.65% NA
All Japonica  1512 83.30% 0.90% 2.51% 13.23% NA
Aus  269 98.10% 0.70% 1.12% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 0.30% 1.02% 2.29% NA
Temperate Japonica  767 72.60% 1.20% 3.26% 22.95% NA
Tropical Japonica  504 99.40% 0.00% 0.20% 0.40% NA
Japonica Intermediate  241 83.80% 2.10% 4.98% 9.13% NA
VI/Aromatic  96 43.80% 9.40% 41.67% 5.21% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710830865 A -> DEL N N silent_mutation Average:35.233; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N
vg0710830865 A -> G LOC_Os07g18270.1 upstream_gene_variant ; 1267.0bp to feature; MODIFIER silent_mutation Average:35.233; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N
vg0710830865 A -> G LOC_Os07g18260.1 downstream_gene_variant ; 3863.0bp to feature; MODIFIER silent_mutation Average:35.233; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N
vg0710830865 A -> G LOC_Os07g18280.1 downstream_gene_variant ; 3979.0bp to feature; MODIFIER silent_mutation Average:35.233; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N
vg0710830865 A -> G LOC_Os07g18270-LOC_Os07g18280 intergenic_region ; MODIFIER silent_mutation Average:35.233; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710830865 NA 6.16E-06 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710830865 5.97E-06 5.97E-06 mr1950 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710830865 NA 4.43E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710830865 1.75E-06 1.34E-06 mr1203_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710830865 NA 5.05E-07 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710830865 4.11E-06 4.62E-08 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251