\
| Variant ID: vg0710825207 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10825207 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGGTGTTTAGATGGGGCTAAAATTTTCTTAGTCCATGTCACATCGAATGTTTGGACGCTAATTTAAAGTATTAAACATAGACTAATATAAAACCTAATTT[T/C]
ATAAATGAGAGCTAATCCGCGAGACGATTTTTTTAAGCCTAATTAATTCATAATTATCAAAAGTTTACTGTAGCATCACATTGTCAAAATTATGGCGTAA
TTACGCCATAATTTTGACAATGTGATGCTACAGTAAACTTTTGATAATTATGAATTAATTAGGCTTAAAAAAATCGTCTCGCGGATTAGCTCTCATTTAT[A/G]
AAATTAGGTTTTATATTAGTCTATGTTTAATACTTTAAATTAGCGTCCAAACATTCGATGTGACATGGACTAAGAAAATTTTAGCCCCATCTAAACACCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.00% | 28.40% | 2.12% | 9.44% | NA |
| All Indica | 2759 | 92.90% | 1.70% | 2.83% | 2.57% | NA |
| All Japonica | 1512 | 5.80% | 75.00% | 0.20% | 19.05% | NA |
| Aus | 269 | 41.30% | 49.10% | 4.83% | 4.83% | NA |
| Indica I | 595 | 97.50% | 0.30% | 1.85% | 0.34% | NA |
| Indica II | 465 | 92.00% | 3.70% | 3.23% | 1.08% | NA |
| Indica III | 913 | 94.60% | 0.80% | 3.94% | 0.66% | NA |
| Indica Intermediate | 786 | 87.90% | 2.70% | 2.04% | 7.38% | NA |
| Temperate Japonica | 767 | 2.00% | 65.70% | 0.26% | 32.07% | NA |
| Tropical Japonica | 504 | 13.30% | 85.90% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 2.10% | 81.70% | 0.00% | 16.18% | NA |
| VI/Aromatic | 96 | 25.00% | 0.00% | 2.08% | 72.92% | NA |
| Intermediate | 90 | 56.70% | 34.40% | 4.44% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710825207 | T -> DEL | N | N | silent_mutation | Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837 | N | N | N | N |
| vg0710825207 | T -> C | LOC_Os07g18250.1 | upstream_gene_variant ; 124.0bp to feature; MODIFIER | silent_mutation | Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837 | N | N | N | N |
| vg0710825207 | T -> C | LOC_Os07g18260.1 | upstream_gene_variant ; 407.0bp to feature; MODIFIER | silent_mutation | Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837 | N | N | N | N |
| vg0710825207 | T -> C | LOC_Os07g18250.2 | upstream_gene_variant ; 124.0bp to feature; MODIFIER | silent_mutation | Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837 | N | N | N | N |
| vg0710825207 | T -> C | LOC_Os07g18270.1 | downstream_gene_variant ; 2618.0bp to feature; MODIFIER | silent_mutation | Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837 | N | N | N | N |
| vg0710825207 | T -> C | LOC_Os07g18250-LOC_Os07g18260 | intergenic_region ; MODIFIER | silent_mutation | Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710825207 | NA | 1.48E-12 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710825207 | NA | 4.65E-49 | mr1211 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710825207 | NA | 3.41E-11 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710825207 | NA | 4.22E-12 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710825207 | NA | 1.14E-07 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710825207 | NA | 2.14E-08 | mr1946 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710825207 | NA | 1.00E-13 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710825207 | NA | 1.30E-13 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710825207 | NA | 2.91E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |