\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710825207:

Variant ID: vg0710825207 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10825207
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGTGTTTAGATGGGGCTAAAATTTTCTTAGTCCATGTCACATCGAATGTTTGGACGCTAATTTAAAGTATTAAACATAGACTAATATAAAACCTAATTT[T/C]
ATAAATGAGAGCTAATCCGCGAGACGATTTTTTTAAGCCTAATTAATTCATAATTATCAAAAGTTTACTGTAGCATCACATTGTCAAAATTATGGCGTAA

Reverse complement sequence

TTACGCCATAATTTTGACAATGTGATGCTACAGTAAACTTTTGATAATTATGAATTAATTAGGCTTAAAAAAATCGTCTCGCGGATTAGCTCTCATTTAT[A/G]
AAATTAGGTTTTATATTAGTCTATGTTTAATACTTTAAATTAGCGTCCAAACATTCGATGTGACATGGACTAAGAAAATTTTAGCCCCATCTAAACACCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 28.40% 2.12% 9.44% NA
All Indica  2759 92.90% 1.70% 2.83% 2.57% NA
All Japonica  1512 5.80% 75.00% 0.20% 19.05% NA
Aus  269 41.30% 49.10% 4.83% 4.83% NA
Indica I  595 97.50% 0.30% 1.85% 0.34% NA
Indica II  465 92.00% 3.70% 3.23% 1.08% NA
Indica III  913 94.60% 0.80% 3.94% 0.66% NA
Indica Intermediate  786 87.90% 2.70% 2.04% 7.38% NA
Temperate Japonica  767 2.00% 65.70% 0.26% 32.07% NA
Tropical Japonica  504 13.30% 85.90% 0.20% 0.60% NA
Japonica Intermediate  241 2.10% 81.70% 0.00% 16.18% NA
VI/Aromatic  96 25.00% 0.00% 2.08% 72.92% NA
Intermediate  90 56.70% 34.40% 4.44% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710825207 T -> DEL N N silent_mutation Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837 N N N N
vg0710825207 T -> C LOC_Os07g18250.1 upstream_gene_variant ; 124.0bp to feature; MODIFIER silent_mutation Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837 N N N N
vg0710825207 T -> C LOC_Os07g18260.1 upstream_gene_variant ; 407.0bp to feature; MODIFIER silent_mutation Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837 N N N N
vg0710825207 T -> C LOC_Os07g18250.2 upstream_gene_variant ; 124.0bp to feature; MODIFIER silent_mutation Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837 N N N N
vg0710825207 T -> C LOC_Os07g18270.1 downstream_gene_variant ; 2618.0bp to feature; MODIFIER silent_mutation Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837 N N N N
vg0710825207 T -> C LOC_Os07g18250-LOC_Os07g18260 intergenic_region ; MODIFIER silent_mutation Average:83.815; most accessible tissue: Minghui63 panicle, score: 93.837 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710825207 NA 1.48E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207 NA 4.65E-49 mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207 NA 3.41E-11 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207 NA 4.22E-12 mr1329 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207 NA 1.14E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207 NA 2.14E-08 mr1946 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207 NA 1.00E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207 NA 1.30E-13 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710825207 NA 2.91E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251