\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710562047:

Variant ID: vg0710562047 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10562047
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGTAATGGGGGATCCCTGAAAAATTTTTACCAGGTAATACAGTTGTTTCTACTTTCAACTACTATTGAGAGAACCACACCCTTCGACGTGACGCAGTT[G/A]
TCGTTCGACAACATCTTTCTTTTGAACTATCTACCACTACTAGAAAAATTGTCTTTCCAGATTTTCCTTGGCGAGGGGAAGGTCCGCCTGCACGCGCGGC

Reverse complement sequence

GCCGCGCGTGCAGGCGGACCTTCCCCTCGCCAAGGAAAATCTGGAAAGACAATTTTTCTAGTAGTGGTAGATAGTTCAAAAGAAAGATGTTGTCGAACGA[C/T]
AACTGCGTCACGTCGAAGGGTGTGGTTCTCTCAATAGTAGTTGAAAGTAGAAACAACTGTATTACCTGGTAAAAATTTTTCAGGGATCCCCCATTACATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 38.10% 0.11% 0.30% NA
All Indica  2759 95.50% 4.20% 0.14% 0.11% NA
All Japonica  1512 5.80% 93.60% 0.07% 0.53% NA
Aus  269 40.90% 58.70% 0.00% 0.37% NA
Indica I  595 98.80% 0.80% 0.17% 0.17% NA
Indica II  465 96.10% 3.70% 0.22% 0.00% NA
Indica III  913 98.20% 1.50% 0.11% 0.11% NA
Indica Intermediate  786 89.60% 10.20% 0.13% 0.13% NA
Temperate Japonica  767 2.10% 96.90% 0.00% 1.04% NA
Tropical Japonica  504 13.30% 86.50% 0.20% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 54.40% 43.30% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710562047 G -> DEL N N silent_mutation Average:61.607; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0710562047 G -> A LOC_Os07g17850.1 downstream_gene_variant ; 2886.0bp to feature; MODIFIER silent_mutation Average:61.607; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0710562047 G -> A LOC_Os07g17840-LOC_Os07g17850 intergenic_region ; MODIFIER silent_mutation Average:61.607; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710562047 NA 2.34E-08 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710562047 NA 3.54E-06 mr1245 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710562047 2.53E-06 2.53E-06 mr1373 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710562047 NA 4.72E-07 mr1453 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710562047 NA 8.72E-07 mr1510 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710562047 NA 1.83E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710562047 1.34E-06 7.51E-10 mr1648 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710562047 NA 1.16E-07 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710562047 2.56E-08 1.47E-10 mr1697 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710562047 1.08E-06 1.08E-06 mr1976 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251