| Variant ID: vg0710562047 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10562047 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CATGTAATGGGGGATCCCTGAAAAATTTTTACCAGGTAATACAGTTGTTTCTACTTTCAACTACTATTGAGAGAACCACACCCTTCGACGTGACGCAGTT[G/A]
TCGTTCGACAACATCTTTCTTTTGAACTATCTACCACTACTAGAAAAATTGTCTTTCCAGATTTTCCTTGGCGAGGGGAAGGTCCGCCTGCACGCGCGGC
GCCGCGCGTGCAGGCGGACCTTCCCCTCGCCAAGGAAAATCTGGAAAGACAATTTTTCTAGTAGTGGTAGATAGTTCAAAAGAAAGATGTTGTCGAACGA[C/T]
AACTGCGTCACGTCGAAGGGTGTGGTTCTCTCAATAGTAGTTGAAAGTAGAAACAACTGTATTACCTGGTAAAAATTTTTCAGGGATCCCCCATTACATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.50% | 38.10% | 0.11% | 0.30% | NA |
| All Indica | 2759 | 95.50% | 4.20% | 0.14% | 0.11% | NA |
| All Japonica | 1512 | 5.80% | 93.60% | 0.07% | 0.53% | NA |
| Aus | 269 | 40.90% | 58.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 98.80% | 0.80% | 0.17% | 0.17% | NA |
| Indica II | 465 | 96.10% | 3.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.50% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 89.60% | 10.20% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 2.10% | 96.90% | 0.00% | 1.04% | NA |
| Tropical Japonica | 504 | 13.30% | 86.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 22.90% | 77.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 43.30% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710562047 | G -> DEL | N | N | silent_mutation | Average:61.607; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0710562047 | G -> A | LOC_Os07g17850.1 | downstream_gene_variant ; 2886.0bp to feature; MODIFIER | silent_mutation | Average:61.607; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| vg0710562047 | G -> A | LOC_Os07g17840-LOC_Os07g17850 | intergenic_region ; MODIFIER | silent_mutation | Average:61.607; most accessible tissue: Minghui63 panicle, score: 82.128 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710562047 | NA | 2.34E-08 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710562047 | NA | 3.54E-06 | mr1245 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710562047 | 2.53E-06 | 2.53E-06 | mr1373 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710562047 | NA | 4.72E-07 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710562047 | NA | 8.72E-07 | mr1510 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710562047 | NA | 1.83E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710562047 | 1.34E-06 | 7.51E-10 | mr1648 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710562047 | NA | 1.16E-07 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710562047 | 2.56E-08 | 1.47E-10 | mr1697 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710562047 | 1.08E-06 | 1.08E-06 | mr1976 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |