\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710493875:

Variant ID: vg0710493875 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10493875
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGAAGTACCACCACGGCACTGCAAAGGGGGAAATCGTGACAATACCCTTCGCACAACACAACTCACCACAGTGCACCATTCCTGGATCATAATCACCCC[C/A]
TCAAAAACAAGAGGCATGGACTCCCCAGTGACCCCCACAGACTTCTCGCCGCTTCTCAGTCTGGCACCCTGTAATGAACCATGCTATACAAAAGATAAAG

Reverse complement sequence

CTTTATCTTTTGTATAGCATGGTTCATTACAGGGTGCCAGACTGAGAAGCGGCGAGAAGTCTGTGGGGGTCACTGGGGAGTCCATGCCTCTTGTTTTTGA[G/T]
GGGGTGATTATGATCCAGGAATGGTGCACTGTGGTGAGTTGTGTTGTGCGAAGGGTATTGTCACGATTTCCCCCTTTGCAGTGCCGTGGTGGTACTTCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 12.10% 16.55% 2.48% NA
All Indica  2759 51.30% 20.70% 25.73% 2.32% NA
All Japonica  1512 96.10% 0.00% 1.12% 2.78% NA
Aus  269 84.00% 0.00% 13.38% 2.60% NA
Indica I  595 46.90% 20.80% 31.76% 0.50% NA
Indica II  465 57.40% 14.20% 26.67% 1.72% NA
Indica III  913 46.00% 28.10% 22.12% 3.72% NA
Indica Intermediate  786 57.10% 15.60% 24.81% 2.42% NA
Temperate Japonica  767 92.40% 0.00% 2.09% 5.48% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 3.12% 0.00% NA
Intermediate  90 75.60% 2.20% 17.78% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710493875 C -> DEL N N silent_mutation Average:12.817; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0710493875 C -> A LOC_Os07g17760.1 upstream_gene_variant ; 1331.0bp to feature; MODIFIER silent_mutation Average:12.817; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0710493875 C -> A LOC_Os07g17760-LOC_Os07g17770 intergenic_region ; MODIFIER silent_mutation Average:12.817; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710493875 NA 4.80E-07 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493875 NA 1.92E-06 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493875 1.14E-06 1.05E-17 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493875 2.32E-08 3.24E-21 mr1709 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493875 NA 6.58E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493875 NA 2.06E-08 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493875 6.11E-06 6.70E-11 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493875 1.15E-06 2.41E-11 mr1547_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493875 4.93E-09 1.69E-36 mr1709_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493875 1.22E-09 5.39E-35 mr1709_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251