\
| Variant ID: vg0710493875 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10493875 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCGAAGTACCACCACGGCACTGCAAAGGGGGAAATCGTGACAATACCCTTCGCACAACACAACTCACCACAGTGCACCATTCCTGGATCATAATCACCCC[C/A]
TCAAAAACAAGAGGCATGGACTCCCCAGTGACCCCCACAGACTTCTCGCCGCTTCTCAGTCTGGCACCCTGTAATGAACCATGCTATACAAAAGATAAAG
CTTTATCTTTTGTATAGCATGGTTCATTACAGGGTGCCAGACTGAGAAGCGGCGAGAAGTCTGTGGGGGTCACTGGGGAGTCCATGCCTCTTGTTTTTGA[G/T]
GGGGTGATTATGATCCAGGAATGGTGCACTGTGGTGAGTTGTGTTGTGCGAAGGGTATTGTCACGATTTCCCCCTTTGCAGTGCCGTGGTGGTACTTCGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.90% | 12.10% | 16.55% | 2.48% | NA |
| All Indica | 2759 | 51.30% | 20.70% | 25.73% | 2.32% | NA |
| All Japonica | 1512 | 96.10% | 0.00% | 1.12% | 2.78% | NA |
| Aus | 269 | 84.00% | 0.00% | 13.38% | 2.60% | NA |
| Indica I | 595 | 46.90% | 20.80% | 31.76% | 0.50% | NA |
| Indica II | 465 | 57.40% | 14.20% | 26.67% | 1.72% | NA |
| Indica III | 913 | 46.00% | 28.10% | 22.12% | 3.72% | NA |
| Indica Intermediate | 786 | 57.10% | 15.60% | 24.81% | 2.42% | NA |
| Temperate Japonica | 767 | 92.40% | 0.00% | 2.09% | 5.48% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 2.20% | 17.78% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710493875 | C -> DEL | N | N | silent_mutation | Average:12.817; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0710493875 | C -> A | LOC_Os07g17760.1 | upstream_gene_variant ; 1331.0bp to feature; MODIFIER | silent_mutation | Average:12.817; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0710493875 | C -> A | LOC_Os07g17760-LOC_Os07g17770 | intergenic_region ; MODIFIER | silent_mutation | Average:12.817; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710493875 | NA | 4.80E-07 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493875 | NA | 1.92E-06 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493875 | 1.14E-06 | 1.05E-17 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493875 | 2.32E-08 | 3.24E-21 | mr1709 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493875 | NA | 6.58E-06 | mr1291_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493875 | NA | 2.06E-08 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493875 | 6.11E-06 | 6.70E-11 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493875 | 1.15E-06 | 2.41E-11 | mr1547_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493875 | 4.93E-09 | 1.69E-36 | mr1709_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493875 | 1.22E-09 | 5.39E-35 | mr1709_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |