\
| Variant ID: vg0710493467 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10493467 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CACACAGGAATTATGCAAGTGCACAAGGATACCAAAGGATGGCATAATATAGGGTTTATTTGTGAAAGCAACATTTAGCAAAGATTTAAGAGTAGTAAAA[T/C]
AGTAGAGTAATTAATCATCAATATTAATCAACACTGAACAACACACCCATGCTGCACAGGCCCAACCAAACCTGAACAACCAACCCTGGTTGTACAGATC
GATCTGTACAACCAGGGTTGGTTGTTCAGGTTTGGTTGGGCCTGTGCAGCATGGGTGTGTTGTTCAGTGTTGATTAATATTGATGATTAATTACTCTACT[A/G]
TTTTACTACTCTTAAATCTTTGCTAAATGTTGCTTTCACAAATAAACCCTATATTATGCCATCCTTTGGTATCCTTGTGCACTTGCATAATTCCTGTGTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.40% | 0.50% | 9.44% | 23.64% | NA |
| All Indica | 2759 | 53.10% | 0.30% | 13.52% | 33.02% | NA |
| All Japonica | 1512 | 93.30% | 0.00% | 1.39% | 5.36% | NA |
| Aus | 269 | 62.50% | 4.50% | 8.55% | 24.54% | NA |
| Indica I | 595 | 49.70% | 0.00% | 16.81% | 33.45% | NA |
| Indica II | 465 | 57.60% | 0.00% | 12.90% | 29.46% | NA |
| Indica III | 913 | 52.10% | 0.90% | 11.28% | 35.71% | NA |
| Indica Intermediate | 786 | 54.20% | 0.10% | 13.99% | 31.68% | NA |
| Temperate Japonica | 767 | 92.70% | 0.00% | 1.56% | 5.74% | NA |
| Tropical Japonica | 504 | 91.50% | 0.00% | 1.59% | 6.94% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 39.60% | 1.00% | 20.83% | 38.54% | NA |
| Intermediate | 90 | 63.30% | 2.20% | 10.00% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710493467 | T -> DEL | N | N | silent_mutation | Average:9.84; most accessible tissue: Callus, score: 38.707 | N | N | N | N |
| vg0710493467 | T -> C | LOC_Os07g17760.1 | upstream_gene_variant ; 923.0bp to feature; MODIFIER | silent_mutation | Average:9.84; most accessible tissue: Callus, score: 38.707 | N | N | N | N |
| vg0710493467 | T -> C | LOC_Os07g17760-LOC_Os07g17770 | intergenic_region ; MODIFIER | silent_mutation | Average:9.84; most accessible tissue: Callus, score: 38.707 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710493467 | NA | 4.82E-07 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493467 | NA | 5.62E-11 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493467 | NA | 2.53E-13 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493467 | NA | 1.02E-06 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493467 | NA | 8.30E-09 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493467 | 3.31E-06 | 7.16E-10 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493467 | 5.41E-10 | 3.94E-25 | mr1709_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710493467 | 1.04E-07 | 3.84E-24 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |