Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0710493467:

Variant ID: vg0710493467 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 10493467
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACACAGGAATTATGCAAGTGCACAAGGATACCAAAGGATGGCATAATATAGGGTTTATTTGTGAAAGCAACATTTAGCAAAGATTTAAGAGTAGTAAAA[T/C]
AGTAGAGTAATTAATCATCAATATTAATCAACACTGAACAACACACCCATGCTGCACAGGCCCAACCAAACCTGAACAACCAACCCTGGTTGTACAGATC

Reverse complement sequence

GATCTGTACAACCAGGGTTGGTTGTTCAGGTTTGGTTGGGCCTGTGCAGCATGGGTGTGTTGTTCAGTGTTGATTAATATTGATGATTAATTACTCTACT[A/G]
TTTTACTACTCTTAAATCTTTGCTAAATGTTGCTTTCACAAATAAACCCTATATTATGCCATCCTTTGGTATCCTTGTGCACTTGCATAATTCCTGTGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.40%	0.50%	9.44%	23.64%	NA
All Indica	2759	53.10%	0.30%	13.52%	33.02%	NA
All Japonica	1512	93.30%	0.00%	1.39%	5.36%	NA
Aus	269	62.50%	4.50%	8.55%	24.54%	NA
Indica I	595	49.70%	0.00%	16.81%	33.45%	NA
Indica II	465	57.60%	0.00%	12.90%	29.46%	NA
Indica III	913	52.10%	0.90%	11.28%	35.71%	NA
Indica Intermediate	786	54.20%	0.10%	13.99%	31.68%	NA
Temperate Japonica	767	92.70%	0.00%	1.56%	5.74%	NA
Tropical Japonica	504	91.50%	0.00%	1.59%	6.94%	NA
Japonica Intermediate	241	98.80%	0.00%	0.41%	0.83%	NA
VI/Aromatic	96	39.60%	1.00%	20.83%	38.54%	NA
Intermediate	90	63.30%	2.20%	10.00%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0710493467	T -> DEL	N	N	silent_mutation	Average:9.84; most accessible tissue: Callus, score: 38.707	N	N	N	N
vg0710493467	T -> C	LOC_Os07g17760.1	upstream_gene_variant ; 923.0bp to feature; MODIFIER	silent_mutation	Average:9.84; most accessible tissue: Callus, score: 38.707	N	N	N	N
vg0710493467	T -> C	LOC_Os07g17760-LOC_Os07g17770	intergenic_region ; MODIFIER	silent_mutation	Average:9.84; most accessible tissue: Callus, score: 38.707	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0710493467	NA	4.82E-07	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493467	NA	5.62E-11	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493467	NA	2.53E-13	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493467	NA	1.02E-06	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493467	NA	8.30E-09	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493467	3.31E-06	7.16E-10	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493467	5.41E-10	3.94E-25	mr1709_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493467	1.04E-07	3.84E-24	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251