\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710493467:

Variant ID: vg0710493467 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10493467
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACACAGGAATTATGCAAGTGCACAAGGATACCAAAGGATGGCATAATATAGGGTTTATTTGTGAAAGCAACATTTAGCAAAGATTTAAGAGTAGTAAAA[T/C]
AGTAGAGTAATTAATCATCAATATTAATCAACACTGAACAACACACCCATGCTGCACAGGCCCAACCAAACCTGAACAACCAACCCTGGTTGTACAGATC

Reverse complement sequence

GATCTGTACAACCAGGGTTGGTTGTTCAGGTTTGGTTGGGCCTGTGCAGCATGGGTGTGTTGTTCAGTGTTGATTAATATTGATGATTAATTACTCTACT[A/G]
TTTTACTACTCTTAAATCTTTGCTAAATGTTGCTTTCACAAATAAACCCTATATTATGCCATCCTTTGGTATCCTTGTGCACTTGCATAATTCCTGTGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 0.50% 9.44% 23.64% NA
All Indica  2759 53.10% 0.30% 13.52% 33.02% NA
All Japonica  1512 93.30% 0.00% 1.39% 5.36% NA
Aus  269 62.50% 4.50% 8.55% 24.54% NA
Indica I  595 49.70% 0.00% 16.81% 33.45% NA
Indica II  465 57.60% 0.00% 12.90% 29.46% NA
Indica III  913 52.10% 0.90% 11.28% 35.71% NA
Indica Intermediate  786 54.20% 0.10% 13.99% 31.68% NA
Temperate Japonica  767 92.70% 0.00% 1.56% 5.74% NA
Tropical Japonica  504 91.50% 0.00% 1.59% 6.94% NA
Japonica Intermediate  241 98.80% 0.00% 0.41% 0.83% NA
VI/Aromatic  96 39.60% 1.00% 20.83% 38.54% NA
Intermediate  90 63.30% 2.20% 10.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710493467 T -> DEL N N silent_mutation Average:9.84; most accessible tissue: Callus, score: 38.707 N N N N
vg0710493467 T -> C LOC_Os07g17760.1 upstream_gene_variant ; 923.0bp to feature; MODIFIER silent_mutation Average:9.84; most accessible tissue: Callus, score: 38.707 N N N N
vg0710493467 T -> C LOC_Os07g17760-LOC_Os07g17770 intergenic_region ; MODIFIER silent_mutation Average:9.84; most accessible tissue: Callus, score: 38.707 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710493467 NA 4.82E-07 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493467 NA 5.62E-11 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493467 NA 2.53E-13 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493467 NA 1.02E-06 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493467 NA 8.30E-09 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493467 3.31E-06 7.16E-10 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493467 5.41E-10 3.94E-25 mr1709_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710493467 1.04E-07 3.84E-24 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251