\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0710448830:

Variant ID: vg0710448830 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 10448830
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.32, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


GTGAAGCAAGAGTGAAGATCTTGGAGAACCAGTCACAGAACCTAAGCCGCCCTCTAGGGTAGTGTGGTTAGTCGTGTGTTCTTTTGCTTGTGTGTGTAGT[G/A]
CGTGGTTTGCATCGGTGGGTTGTGATGTAACCATGCTAGGTTGTTTGCTTAATCAACTTGCAGAATAAGTGAAACAAACAACACATCAACAAGAAGAGTT

Reverse complement sequence

AACTCTTCTTGTTGATGTGTTGTTTGTTTCACTTATTCTGCAAGTTGATTAAGCAAACAACCTAGCATGGTTACATCACAACCCACCGATGCAAACCACG[C/T]
ACTACACACACAAGCAAAAGAACACACGACTAACCACACTACCCTAGAGGGCGGCTTAGGTTCTGTGACTGGTTCTCCAAGATCTTCACTCTTGCTTCAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 37.30% 1.25% 1.93% NA
All Indica  2759 94.80% 4.60% 0.51% 0.11% NA
All Japonica  1512 1.40% 94.10% 0.13% 4.37% NA
Aus  269 41.60% 56.90% 1.49% 0.00% NA
Indica I  595 97.00% 2.90% 0.17% 0.00% NA
Indica II  465 95.90% 3.90% 0.22% 0.00% NA
Indica III  913 97.90% 0.80% 0.99% 0.33% NA
Indica Intermediate  786 88.80% 10.80% 0.38% 0.00% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 86.70% 0.00% 12.70% NA
Japonica Intermediate  241 1.70% 96.70% 0.83% 0.83% NA
VI/Aromatic  96 19.80% 24.00% 36.46% 19.79% NA
Intermediate  90 48.90% 43.30% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0710448830 G -> DEL N N silent_mutation Average:36.758; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0710448830 G -> A LOC_Os07g17700.1 upstream_gene_variant ; 181.0bp to feature; MODIFIER silent_mutation Average:36.758; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0710448830 G -> A LOC_Os07g17689.1 downstream_gene_variant ; 4684.0bp to feature; MODIFIER silent_mutation Average:36.758; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N
vg0710448830 G -> A LOC_Os07g17689-LOC_Os07g17700 intergenic_region ; MODIFIER silent_mutation Average:36.758; most accessible tissue: Minghui63 young leaf, score: 55.178 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0710448830 NA 1.33E-07 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 NA 7.10E-06 mr1046_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 NA 1.29E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 NA 3.45E-06 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 NA 5.68E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 NA 1.22E-12 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 8.06E-06 8.06E-06 mr1357_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 3.16E-07 3.16E-07 mr1365_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 NA 3.43E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 NA 9.49E-06 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 NA 2.69E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 NA 9.17E-06 mr1551_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 6.66E-07 6.66E-07 mr1643_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 NA 7.69E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 NA 6.58E-06 mr1849_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 NA 1.12E-20 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 NA 1.63E-06 mr1924_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0710448830 NA 7.22E-07 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251