Variant ID: vg0710393280 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 10393280 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 28. )
CCGACTGGAGGAAGAGCGACAGTGACAGGAGCGAGAACGACTACAGCATGAGTAACAAGATCGTGAACAGATTGCAAAGGAGGCTGAAGATCGACGACAA[C/T]
GCGCCTTGCAATCTGGGCGGCGAGTGAGAGAGCTCATTGGGCAACAAGACATCGATGGGACAGCGGTCTTTCGCACCCCCCCAGCAGAACGCGGTTGTAG
CTACAACCGCGTTCTGCTGGGGGGGTGCGAAAGACCGCTGTCCCATCGATGTCTTGTTGCCCAATGAGCTCTCTCACTCGCCGCCCAGATTGCAAGGCGC[G/A]
TTGTCGTCGATCTTCAGCCTCCTTTGCAATCTGTTCACGATCTTGTTACTCATGCTGTAGTCGTTCTCGCTCCTGTCACTGTCGCTCTTCCTCCAGTCGG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 36.90% | 2.80% | 0.91% | 59.37% | NA |
All Indica | 2759 | 8.80% | 0.10% | 1.16% | 89.85% | NA |
All Japonica | 1512 | 87.00% | 8.50% | 0.00% | 4.56% | NA |
Aus | 269 | 50.60% | 0.00% | 2.23% | 47.21% | NA |
Indica I | 595 | 11.80% | 0.30% | 0.84% | 87.06% | NA |
Indica II | 465 | 8.00% | 0.00% | 1.94% | 90.11% | NA |
Indica III | 913 | 3.00% | 0.20% | 0.77% | 96.06% | NA |
Indica Intermediate | 786 | 14.00% | 0.00% | 1.40% | 84.61% | NA |
Temperate Japonica | 767 | 81.50% | 16.70% | 0.00% | 1.83% | NA |
Tropical Japonica | 504 | 90.30% | 0.00% | 0.00% | 9.72% | NA |
Japonica Intermediate | 241 | 97.50% | 0.00% | 0.00% | 2.49% | NA |
VI/Aromatic | 96 | 9.40% | 0.00% | 5.21% | 85.42% | NA |
Intermediate | 90 | 44.40% | 1.10% | 0.00% | 54.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0710393280 | C -> DEL | LOC_Os07g17600.1 | N | frameshift_variant | Average:18.602; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
vg0710393280 | C -> T | LOC_Os07g17600.1 | synonymous_variant ; p.Asn92Asn; LOW | synonymous_codon | Average:18.602; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0710393280 | NA | 2.30E-06 | mr1046_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0710393280 | 3.69E-06 | 3.69E-06 | mr1365_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0710393280 | NA | 2.85E-06 | mr1381_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0710393280 | NA | 4.37E-06 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0710393280 | NA | 1.63E-06 | mr1743_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0710393280 | NA | 1.99E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0710393280 | NA | 3.67E-06 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0710393280 | NA | 5.25E-06 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |