| Variant ID: vg0710154939 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 10154939 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAGCAATGATAATAAAGAGAAGATGCAGTGGACGGTTGTACAGGAGTATAATAGCAGTGTTTAACGGGACTTCTAGAAATTATAAAAAAGAAGCCCAACA[G/T,A]
GACAATAAACTCTAAAAACTAAGTTTTTAGATCCAATGTTTAAAGGTTCCAAGGAGAATGAATAGAAACAGCGGTAGATTGAGCAAGCTAAGGGGTAGCA
TGCTACCCCTTAGCTTGCTCAATCTACCGCTGTTTCTATTCATTCTCCTTGGAACCTTTAAACATTGGATCTAAAAACTTAGTTTTTAGAGTTTATTGTC[C/A,T]
TGTTGGGCTTCTTTTTTATAATTTCTAGAAGTCCCGTTAAACACTGCTATTATACTCCTGTACAACCGTCCACTGCATCTTCTCTTTATTATCATTGCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 4.90% | 1.88% | 0.74% | T: 0.02% |
| All Indica | 2759 | 97.40% | 0.20% | 1.23% | 1.16% | T: 0.04% |
| All Japonica | 1512 | 82.90% | 13.80% | 3.11% | 0.20% | NA |
| Aus | 269 | 92.90% | 4.50% | 2.60% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 0.00% | 0.99% | 0.11% | T: 0.11% |
| Indica Intermediate | 786 | 92.60% | 0.40% | 3.05% | 3.94% | NA |
| Temperate Japonica | 767 | 82.90% | 11.00% | 5.74% | 0.39% | NA |
| Tropical Japonica | 504 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 57.30% | 41.50% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0710154939 | G -> DEL | N | N | silent_mutation | Average:42.404; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
| vg0710154939 | G -> A | LOC_Os07g17230.1 | downstream_gene_variant ; 513.0bp to feature; MODIFIER | silent_mutation | Average:42.404; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
| vg0710154939 | G -> A | LOC_Os07g17220-LOC_Os07g17230 | intergenic_region ; MODIFIER | silent_mutation | Average:42.404; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
| vg0710154939 | G -> T | LOC_Os07g17230.1 | downstream_gene_variant ; 513.0bp to feature; MODIFIER | silent_mutation | Average:42.404; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
| vg0710154939 | G -> T | LOC_Os07g17220-LOC_Os07g17230 | intergenic_region ; MODIFIER | silent_mutation | Average:42.404; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0710154939 | NA | 1.22E-07 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710154939 | NA | 2.79E-06 | mr1510 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710154939 | NA | 3.67E-06 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710154939 | NA | 1.62E-07 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710154939 | NA | 1.27E-07 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710154939 | NA | 6.77E-07 | mr1318_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710154939 | NA | 4.24E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710154939 | NA | 6.96E-07 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710154939 | NA | 9.18E-08 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710154939 | 6.31E-06 | NA | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0710154939 | NA | 4.74E-08 | mr1788_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |