Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0709968476:

Variant ID: vg0709968476 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9968476
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTCTAATGAAAAGTAATTAATTTATGGATAAAATTTTTATATACGTGTTCTTAGCGATTTAAAAGAAAAAAACTGAAAAATAAACTTCGATAAAAAAA[C/A]
CTTAAAATCAACTTCAAATTTAATGTTGAAAAATCAAATTTTAGTTGAAAAGTATAAGCATAAGCGAAAATATGAGATTCTTAGTCGAGCATGAGCAGAT

Reverse complement sequence

ATCTGCTCATGCTCGACTAAGAATCTCATATTTTCGCTTATGCTTATACTTTTCAACTAAAATTTGATTTTTCAACATTAAATTTGAAGTTGATTTTAAG[G/T]
TTTTTTTATCGAAGTTTATTTTTCAGTTTTTTTCTTTTAAATCGCTAAGAACACGTATATAAAAATTTTATCCATAAATTAATTACTTTTCATTAGAATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.70% 37.30% 0.30% 13.73% NA
All Indica  2759 79.20% 9.70% 0.14% 10.98% NA
All Japonica  1512 1.70% 75.90% 0.40% 22.09% NA
Aus  269 13.40% 86.60% 0.00% 0.00% NA
Indica I  595 66.40% 2.50% 0.17% 30.92% NA
Indica II  465 89.70% 4.90% 0.00% 5.38% NA
Indica III  913 89.30% 10.30% 0.11% 0.33% NA
Indica Intermediate  786 70.90% 17.30% 0.25% 11.58% NA
Temperate Japonica  767 2.00% 64.40% 0.65% 32.99% NA
Tropical Japonica  504 1.00% 98.00% 0.00% 0.99% NA
Japonica Intermediate  241 2.10% 66.00% 0.41% 31.54% NA
VI/Aromatic  96 16.70% 72.90% 2.08% 8.33% NA
Intermediate  90 45.60% 47.80% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709968476 C -> DEL N N silent_mutation Average:44.172; most accessible tissue: Callus, score: 60.27 N N N N
vg0709968476 C -> A LOC_Os07g16950.1 upstream_gene_variant ; 3891.0bp to feature; MODIFIER silent_mutation Average:44.172; most accessible tissue: Callus, score: 60.27 N N N N
vg0709968476 C -> A LOC_Os07g16950.5 upstream_gene_variant ; 3888.0bp to feature; MODIFIER silent_mutation Average:44.172; most accessible tissue: Callus, score: 60.27 N N N N
vg0709968476 C -> A LOC_Os07g16950.3 upstream_gene_variant ; 3891.0bp to feature; MODIFIER silent_mutation Average:44.172; most accessible tissue: Callus, score: 60.27 N N N N
vg0709968476 C -> A LOC_Os07g16950.4 upstream_gene_variant ; 3891.0bp to feature; MODIFIER silent_mutation Average:44.172; most accessible tissue: Callus, score: 60.27 N N N N
vg0709968476 C -> A LOC_Os07g16950.2 upstream_gene_variant ; 3891.0bp to feature; MODIFIER silent_mutation Average:44.172; most accessible tissue: Callus, score: 60.27 N N N N
vg0709968476 C -> A LOC_Os07g16930.1 downstream_gene_variant ; 2897.0bp to feature; MODIFIER silent_mutation Average:44.172; most accessible tissue: Callus, score: 60.27 N N N N
vg0709968476 C -> A LOC_Os07g16930-LOC_Os07g16950 intergenic_region ; MODIFIER silent_mutation Average:44.172; most accessible tissue: Callus, score: 60.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709968476 NA 4.12E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 2.73E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 6.28E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 2.56E-08 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 5.20E-15 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 3.19E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 5.54E-07 mr1046_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 8.26E-06 8.26E-06 mr1048_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 4.24E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 8.21E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 1.95E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 3.46E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 5.43E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 1.92E-16 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 4.03E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 3.45E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 5.11E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 3.74E-07 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 1.23E-06 mr1388_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 9.95E-06 9.95E-06 mr1391_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 1.00E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 1.40E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 1.43E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 2.04E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 1.23E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 6.16E-06 mr1442_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 1.28E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 1.40E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 3.31E-06 mr1554_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 7.93E-38 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 8.89E-07 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 6.13E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 8.99E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 3.30E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 1.97E-07 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 5.18E-06 5.18E-06 mr1643_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 4.65E-06 mr1646_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 5.27E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 2.00E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 3.04E-07 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 3.23E-06 NA mr1733_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 8.64E-09 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 4.58E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 2.16E-06 NA mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 3.27E-07 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 6.44E-14 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 9.74E-06 mr1751_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 7.79E-06 7.79E-06 mr1783_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 1.00E-36 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 8.40E-07 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 3.92E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 9.52E-20 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 3.06E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 3.59E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 4.33E-26 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 3.54E-07 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 3.47E-07 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709968476 NA 3.36E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251