\
| Variant ID: vg0709781857 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9781857 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAGTGAACCACCGTCATCATCGTCATCATCTTCATCTTCGTCATCCGATAGACATCCACGGAGGACACACAATCGCCGACAACCCACCGCCCCCTGCACT[G/A]
GGTGTAGAGCTTTCAACCGTTCTCTACGTGATGTCCGATGGCCCGAGAGATTCCGACCCGGAGCAATAGAGAAGTACGATGGGAGTACTGACCCTGAAGA
TCTTCAGGGTCAGTACTCCCATCGTACTTCTCTATTGCTCCGGGTCGGAATCTCTCGGGCCATCGGACATCACGTAGAGAACGGTTGAAAGCTCTACACC[C/T]
AGTGCAGGGGGCGGTGGGTTGTCGGCGATTGTGTGTCCTCCGTGGATGTCTATCGGATGACGAAGATGAAGATGATGACGATGATGACGGTGGTTCACTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.60% | 0.20% | 3.43% | 28.71% | NA |
| All Indica | 2759 | 52.80% | 0.00% | 2.68% | 44.51% | NA |
| All Japonica | 1512 | 88.90% | 0.50% | 5.36% | 5.29% | NA |
| Aus | 269 | 95.90% | 0.00% | 1.12% | 2.97% | NA |
| Indica I | 595 | 52.60% | 0.00% | 2.86% | 44.54% | NA |
| Indica II | 465 | 36.80% | 0.00% | 2.37% | 60.86% | NA |
| Indica III | 913 | 60.80% | 0.00% | 2.74% | 36.47% | NA |
| Indica Intermediate | 786 | 53.10% | 0.10% | 2.67% | 44.15% | NA |
| Temperate Japonica | 767 | 91.30% | 0.80% | 6.13% | 1.83% | NA |
| Tropical Japonica | 504 | 89.10% | 0.00% | 1.19% | 9.72% | NA |
| Japonica Intermediate | 241 | 80.90% | 0.40% | 11.62% | 7.05% | NA |
| VI/Aromatic | 96 | 81.20% | 3.10% | 4.17% | 11.46% | NA |
| Intermediate | 90 | 66.70% | 0.00% | 0.00% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709781857 | G -> DEL | N | N | silent_mutation | Average:34.53; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg0709781857 | G -> A | LOC_Os07g16660.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:34.53; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg0709781857 | G -> A | LOC_Os07g16650.1 | upstream_gene_variant ; 2392.0bp to feature; MODIFIER | silent_mutation | Average:34.53; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg0709781857 | G -> A | LOC_Os07g16670.1 | upstream_gene_variant ; 1691.0bp to feature; MODIFIER | silent_mutation | Average:34.53; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg0709781857 | G -> A | LOC_Os07g16680.1 | downstream_gene_variant ; 4037.0bp to feature; MODIFIER | silent_mutation | Average:34.53; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709781857 | 3.07E-06 | NA | mr1282 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709781857 | NA | 1.80E-08 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709781857 | NA | 8.61E-09 | mr1624 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709781857 | 2.60E-06 | NA | mr1658 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709781857 | 2.83E-08 | 2.46E-10 | mr1057_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709781857 | NA | 2.66E-10 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709781857 | NA | 6.57E-08 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709781857 | NA | 5.63E-07 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709781857 | NA | 3.84E-10 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709781857 | NA | 4.93E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709781857 | NA | 6.11E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709781857 | NA | 2.64E-06 | mr1887_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |