\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709781857:

Variant ID: vg0709781857 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9781857
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGTGAACCACCGTCATCATCGTCATCATCTTCATCTTCGTCATCCGATAGACATCCACGGAGGACACACAATCGCCGACAACCCACCGCCCCCTGCACT[G/A]
GGTGTAGAGCTTTCAACCGTTCTCTACGTGATGTCCGATGGCCCGAGAGATTCCGACCCGGAGCAATAGAGAAGTACGATGGGAGTACTGACCCTGAAGA

Reverse complement sequence

TCTTCAGGGTCAGTACTCCCATCGTACTTCTCTATTGCTCCGGGTCGGAATCTCTCGGGCCATCGGACATCACGTAGAGAACGGTTGAAAGCTCTACACC[C/T]
AGTGCAGGGGGCGGTGGGTTGTCGGCGATTGTGTGTCCTCCGTGGATGTCTATCGGATGACGAAGATGAAGATGATGACGATGATGACGGTGGTTCACTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 0.20% 3.43% 28.71% NA
All Indica  2759 52.80% 0.00% 2.68% 44.51% NA
All Japonica  1512 88.90% 0.50% 5.36% 5.29% NA
Aus  269 95.90% 0.00% 1.12% 2.97% NA
Indica I  595 52.60% 0.00% 2.86% 44.54% NA
Indica II  465 36.80% 0.00% 2.37% 60.86% NA
Indica III  913 60.80% 0.00% 2.74% 36.47% NA
Indica Intermediate  786 53.10% 0.10% 2.67% 44.15% NA
Temperate Japonica  767 91.30% 0.80% 6.13% 1.83% NA
Tropical Japonica  504 89.10% 0.00% 1.19% 9.72% NA
Japonica Intermediate  241 80.90% 0.40% 11.62% 7.05% NA
VI/Aromatic  96 81.20% 3.10% 4.17% 11.46% NA
Intermediate  90 66.70% 0.00% 0.00% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709781857 G -> DEL N N silent_mutation Average:34.53; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0709781857 G -> A LOC_Os07g16660.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:34.53; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0709781857 G -> A LOC_Os07g16650.1 upstream_gene_variant ; 2392.0bp to feature; MODIFIER silent_mutation Average:34.53; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0709781857 G -> A LOC_Os07g16670.1 upstream_gene_variant ; 1691.0bp to feature; MODIFIER silent_mutation Average:34.53; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0709781857 G -> A LOC_Os07g16680.1 downstream_gene_variant ; 4037.0bp to feature; MODIFIER silent_mutation Average:34.53; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709781857 3.07E-06 NA mr1282 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709781857 NA 1.80E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709781857 NA 8.61E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709781857 2.60E-06 NA mr1658 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709781857 2.83E-08 2.46E-10 mr1057_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709781857 NA 2.66E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709781857 NA 6.57E-08 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709781857 NA 5.63E-07 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709781857 NA 3.84E-10 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709781857 NA 4.93E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709781857 NA 6.11E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709781857 NA 2.64E-06 mr1887_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251