\
| Variant ID: vg0709586016 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9586016 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.13, others allele: 0.00, population size: 99. )
GCAAACAACAAATGGTTTGTGGTGTTTTGTGAACCAAATCCAAAAAGCATCTTCAACGCCAAAAAATTTCAAAGAAAAATCTCTCACTTTCGAAAAGAAA[G/A]
AGATTCCTTCTACTTATGACAATAATGCACAATTTGTTACCTTGTTCTCCCCCTTTTGACAATGAGTTCATCAAAATTTTTTTCCTCGGAGAGCTTTGCT
AGCAAAGCTCTCCGAGGAAAAAAATTTTGATGAACTCATTGTCAAAAGGGGGAGAACAAGGTAACAAATTGTGCATTATTGTCATAAGTAGAAGGAATCT[C/T]
TTTCTTTTCGAAAGTGAGAGATTTTTCTTTGAAATTTTTTGGCGTTGAAGATGCTTTTTGGATTTGGTTCACAAAACACCACAAACCATTTGTTGTTTGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.90% | 6.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 81.60% | 18.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 74.60% | 25.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 67.60% | 32.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709586016 | G -> A | LOC_Os07g16400.1 | upstream_gene_variant ; 3498.0bp to feature; MODIFIER | silent_mutation | Average:25.113; most accessible tissue: Callus, score: 50.199 | N | N | N | N |
| vg0709586016 | G -> A | LOC_Os07g16380-LOC_Os07g16400 | intergenic_region ; MODIFIER | silent_mutation | Average:25.113; most accessible tissue: Callus, score: 50.199 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709586016 | NA | 5.92E-09 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709586016 | NA | 1.79E-10 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709586016 | 5.82E-07 | NA | mr1733_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709586016 | NA | 2.20E-09 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709586016 | NA | 1.32E-06 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709586016 | NA | 7.01E-11 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709586016 | NA | 4.76E-07 | mr1741_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709586016 | NA | 9.47E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709586016 | NA | 2.59E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |