Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0709538360:

Variant ID: vg0709538360 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9538360
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

GAACTAGGTTCCAAAGGTGATGACGACATCACTTTGTCGGATACGCTCATAACTTCACACGTTCCAATGATAATTCCAAGTCCAAGTCCAGTTCGGCCTC[C/T]
GGAGACAGCACTGACTTTAAACGGACCTAGCGCCTTCATGCCAACTCCGATTTGGGTGATCTTGGAGTTCGTAGAAAGCTTATCTCGCTACCTTTCAAAT

Reverse complement sequence

ATTTGAAAGGTAGCGAGATAAGCTTTCTACGAACTCCAAGATCACCCAAATCGGAGTTGGCATGAAGGCGCTAGGTCCGTTTAAAGTCAGTGCTGTCTCC[G/A]
GAGGCCGAACTGGACTTGGACTTGGAATTATCATTGGAACGTGTGAAGTTATGAGCGTATCCGACAAAGTGATGTCGTCATCACCTTTGGAACCTAGTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.20%	4.80%	0.00%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.00%	NA
All Japonica	1512	88.40%	11.60%	0.00%	0.00%	NA
Aus	269	95.50%	4.50%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	90.00%	10.00%	0.00%	0.00%	NA
Tropical Japonica	504	95.20%	4.80%	0.00%	0.00%	NA
Japonica Intermediate	241	68.90%	31.10%	0.00%	0.00%	NA
VI/Aromatic	96	70.80%	29.20%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709538360	C -> T	LOC_Os07g16330.1	downstream_gene_variant ; 3509.0bp to feature; MODIFIER	silent_mutation	Average:35.919; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N
vg0709538360	C -> T	LOC_Os07g16330-LOC_Os07g16350	intergenic_region ; MODIFIER	silent_mutation	Average:35.919; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709538360	NA	7.16E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709538360	NA	5.47E-06	mr1028	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709538360	NA	1.87E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709538360	2.52E-06	NA	mr1510	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709538360	NA	6.30E-06	mr1510	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709538360	NA	5.24E-07	mr1652	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709538360	NA	3.04E-06	mr1652	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709538360	NA	6.97E-07	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709538360	NA	5.60E-06	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709538360	NA	9.97E-06	mr1458_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709538360	NA	9.27E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709538360	NA	2.60E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709538360	NA	1.83E-06	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251