\
| Variant ID: vg0709538360 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9538360 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 254. )
GAACTAGGTTCCAAAGGTGATGACGACATCACTTTGTCGGATACGCTCATAACTTCACACGTTCCAATGATAATTCCAAGTCCAAGTCCAGTTCGGCCTC[C/T]
GGAGACAGCACTGACTTTAAACGGACCTAGCGCCTTCATGCCAACTCCGATTTGGGTGATCTTGGAGTTCGTAGAAAGCTTATCTCGCTACCTTTCAAAT
ATTTGAAAGGTAGCGAGATAAGCTTTCTACGAACTCCAAGATCACCCAAATCGGAGTTGGCATGAAGGCGCTAGGTCCGTTTAAAGTCAGTGCTGTCTCC[G/A]
GAGGCCGAACTGGACTTGGACTTGGAATTATCATTGGAACGTGTGAAGTTATGAGCGTATCCGACAAAGTGATGTCGTCATCACCTTTGGAACCTAGTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 70.80% | 29.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709538360 | C -> T | LOC_Os07g16330.1 | downstream_gene_variant ; 3509.0bp to feature; MODIFIER | silent_mutation | Average:35.919; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 | N | N | N | N |
| vg0709538360 | C -> T | LOC_Os07g16330-LOC_Os07g16350 | intergenic_region ; MODIFIER | silent_mutation | Average:35.919; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709538360 | NA | 7.16E-07 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709538360 | NA | 5.47E-06 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709538360 | NA | 1.87E-06 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709538360 | 2.52E-06 | NA | mr1510 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709538360 | NA | 6.30E-06 | mr1510 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709538360 | NA | 5.24E-07 | mr1652 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709538360 | NA | 3.04E-06 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709538360 | NA | 6.97E-07 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709538360 | NA | 5.60E-06 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709538360 | NA | 9.97E-06 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709538360 | NA | 9.27E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709538360 | NA | 2.60E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709538360 | NA | 1.83E-06 | mr1788_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |