\
| Variant ID: vg0709509554 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9509554 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.63, T: 0.38, others allele: 0.00, population size: 168. )
TGCTTGCGACATAATCTGAGTACAAAAGTACCTATCAAGTTATGGAGTTCTATCTTCCTATGCTTTCCGTTTGGTTTGCCAATGGATGGTTGCCTTTGGG[T/C]
CGATTCCTAGCACCCGGGGGCTCGTTGGATGGACCAAGTAACGCAAGGTGCTAAGTATTATTCAGAATAAATCAAAAGCATAGGGATGAGATAAATTTAT
ATAAATTTATCTCATCCCTATGCTTTTGATTTATTCTGAATAATACTTAGCACCTTGCGTTACTTGGTCCATCCAACGAGCCCCCGGGTGCTAGGAATCG[A/G]
CCCAAAGGCAACCATCCATTGGCAAACCAAACGGAAAGCATAGGAAGATAGAACTCCATAACTTGATAGGTACTTTTGTACTCAGATTATGTCGCAAGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.50% | 31.30% | 5.10% | 2.09% | NA |
| All Indica | 2759 | 91.00% | 3.00% | 5.91% | 0.00% | NA |
| All Japonica | 1512 | 11.80% | 79.20% | 2.45% | 6.55% | NA |
| Aus | 269 | 38.70% | 55.00% | 6.32% | 0.00% | NA |
| Indica I | 595 | 81.80% | 2.40% | 15.80% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.10% | 0.65% | 0.00% | NA |
| Indica III | 913 | 96.60% | 1.30% | 2.08% | 0.00% | NA |
| Indica Intermediate | 786 | 89.10% | 5.00% | 5.98% | 0.00% | NA |
| Temperate Japonica | 767 | 4.80% | 80.30% | 2.74% | 12.13% | NA |
| Tropical Japonica | 504 | 16.50% | 83.10% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 24.50% | 67.20% | 5.81% | 2.49% | NA |
| VI/Aromatic | 96 | 56.20% | 22.90% | 20.83% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 33.30% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709509554 | T -> DEL | N | N | silent_mutation | Average:31.996; most accessible tissue: Zhenshan97 flower, score: 61.872 | N | N | N | N |
| vg0709509554 | T -> C | LOC_Os07g16290.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.996; most accessible tissue: Zhenshan97 flower, score: 61.872 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709509554 | NA | 3.61E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 6.86E-16 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 1.32E-07 | mr1280 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 1.69E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 1.30E-09 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 5.62E-08 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 3.16E-14 | mr1379 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 1.24E-09 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 1.50E-08 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 7.72E-06 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 1.56E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 4.61E-07 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 6.00E-08 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 7.71E-08 | mr1788 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 8.98E-06 | mr1875 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | 3.36E-06 | NA | mr1936 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 8.47E-06 | mr1941 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709509554 | NA | 1.99E-06 | mr1110_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |