Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0709480436:

Variant ID: vg0709480436 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9480436
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTAATCCGATTTAACCTTTAAAAATTCATAACTAATTCATCTTAGCTCGGATTTAGTTGGTTCAAGTCTCTAAATTTTTCTAAAATAGAGATCTACAT[A/G]
TTAAAAATATCCACATGTACTTTTCATGCTTGTTTATGTGCTGTTTGGTGATTTTGCTCCTTTCTGTTTAGATTCCGACGTTTCCAGAGAGTCCGTTTTT

Reverse complement sequence

AAAAACGGACTCTCTGGAAACGTCGGAATCTAAACAGAAAGGAGCAAAATCACCAAACAGCACATAAACAAGCATGAAAAGTACATGTGGATATTTTTAA[T/C]
ATGTAGATCTCTATTTTAGAAAAATTTAGAGACTTGAACCAACTAAATCCGAGCTAAGATGAATTAGTTATGAATTTTTAAAGGTTAAATCGGATTAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.00%	33.40%	3.17%	8.46%	NA
All Indica	2759	84.50%	3.90%	5.00%	6.63%	NA
All Japonica	1512	5.40%	83.10%	0.33%	11.24%	NA
Aus	269	32.00%	62.50%	0.37%	5.20%	NA
Indica I	595	66.40%	1.70%	11.43%	20.50%	NA
Indica II	465	90.80%	3.00%	3.87%	2.37%	NA
Indica III	913	99.30%	0.30%	0.22%	0.11%	NA
Indica Intermediate	786	77.20%	10.20%	6.36%	6.23%	NA
Temperate Japonica	767	1.70%	88.10%	0.39%	9.78%	NA
Tropical Japonica	504	11.90%	83.50%	0.00%	4.56%	NA
Japonica Intermediate	241	3.30%	66.00%	0.83%	29.88%	NA
VI/Aromatic	96	53.10%	19.80%	3.12%	23.96%	NA
Intermediate	90	53.30%	32.20%	3.33%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709480436	A -> DEL	N	N	silent_mutation	Average:23.776; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0709480436	A -> G	LOC_Os07g16240.1	downstream_gene_variant ; 1510.0bp to feature; MODIFIER	silent_mutation	Average:23.776; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0709480436	A -> G	LOC_Os07g16240-LOC_Os07g16250	intergenic_region ; MODIFIER	silent_mutation	Average:23.776; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709480436	NA	1.72E-21	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	NA	3.52E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	NA	2.82E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	NA	5.50E-24	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	NA	3.69E-16	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	NA	3.14E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	NA	1.11E-09	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	NA	8.62E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	NA	6.18E-10	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	NA	1.46E-06	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	NA	2.30E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	NA	4.27E-26	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	2.74E-06	2.74E-06	mr1108_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	NA	7.82E-06	mr1110_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	NA	4.18E-06	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	5.83E-06	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	NA	7.59E-17	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	4.19E-06	NA	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436	3.37E-06	3.37E-06	mr1828_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251