\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709480436:

Variant ID: vg0709480436 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9480436
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTAATCCGATTTAACCTTTAAAAATTCATAACTAATTCATCTTAGCTCGGATTTAGTTGGTTCAAGTCTCTAAATTTTTCTAAAATAGAGATCTACAT[A/G]
TTAAAAATATCCACATGTACTTTTCATGCTTGTTTATGTGCTGTTTGGTGATTTTGCTCCTTTCTGTTTAGATTCCGACGTTTCCAGAGAGTCCGTTTTT

Reverse complement sequence

AAAAACGGACTCTCTGGAAACGTCGGAATCTAAACAGAAAGGAGCAAAATCACCAAACAGCACATAAACAAGCATGAAAAGTACATGTGGATATTTTTAA[T/C]
ATGTAGATCTCTATTTTAGAAAAATTTAGAGACTTGAACCAACTAAATCCGAGCTAAGATGAATTAGTTATGAATTTTTAAAGGTTAAATCGGATTAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.00% 33.40% 3.17% 8.46% NA
All Indica  2759 84.50% 3.90% 5.00% 6.63% NA
All Japonica  1512 5.40% 83.10% 0.33% 11.24% NA
Aus  269 32.00% 62.50% 0.37% 5.20% NA
Indica I  595 66.40% 1.70% 11.43% 20.50% NA
Indica II  465 90.80% 3.00% 3.87% 2.37% NA
Indica III  913 99.30% 0.30% 0.22% 0.11% NA
Indica Intermediate  786 77.20% 10.20% 6.36% 6.23% NA
Temperate Japonica  767 1.70% 88.10% 0.39% 9.78% NA
Tropical Japonica  504 11.90% 83.50% 0.00% 4.56% NA
Japonica Intermediate  241 3.30% 66.00% 0.83% 29.88% NA
VI/Aromatic  96 53.10% 19.80% 3.12% 23.96% NA
Intermediate  90 53.30% 32.20% 3.33% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709480436 A -> DEL N N silent_mutation Average:23.776; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0709480436 A -> G LOC_Os07g16240.1 downstream_gene_variant ; 1510.0bp to feature; MODIFIER silent_mutation Average:23.776; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0709480436 A -> G LOC_Os07g16240-LOC_Os07g16250 intergenic_region ; MODIFIER silent_mutation Average:23.776; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709480436 NA 1.72E-21 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 NA 3.52E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 NA 2.82E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 NA 5.50E-24 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 NA 3.69E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 NA 3.14E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 NA 1.11E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 NA 8.62E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 NA 6.18E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 NA 1.46E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 NA 2.30E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 NA 4.27E-26 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 2.74E-06 2.74E-06 mr1108_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 NA 7.82E-06 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 NA 4.18E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 5.83E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 NA 7.59E-17 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 4.19E-06 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709480436 3.37E-06 3.37E-06 mr1828_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251