Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0709350055:

Variant ID: vg0709350055 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9350055
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.17, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

GTTCCACAAGATATATCGGAATTATTTCACTAAGTAGATCGAAAATGTTTCACTCGTTTAAATCGGGTGTTGTTTCACCTTATATAAAAACAATGTTTCA[A/G]
TAAATAGTGAAAGAATGTTTCAATTCACTGCAACATTAGATCTATACATAGTGAAACATTGTGAGTACACTAGGTGAAACATTTTTCGGTGGAACAAAAA

Reverse complement sequence

TTTTTGTTCCACCGAAAAATGTTTCACCTAGTGTACTCACAATGTTTCACTATGTATAGATCTAATGTTGCAGTGAATTGAAACATTCTTTCACTATTTA[T/C]
TGAAACATTGTTTTTATATAAGGTGAAACAACACCCGATTTAAACGAGTGAAACATTTTCGATCTACTTAGTGAAATAATTCCGATATATCTTGTGGAAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.20%	31.00%	7.98%	22.87%	NA
All Indica	2759	3.20%	49.00%	10.22%	37.66%	NA
All Japonica	1512	94.60%	0.60%	4.23%	0.53%	NA
Aus	269	64.30%	26.80%	3.35%	5.58%	NA
Indica I	595	2.00%	73.90%	6.05%	17.98%	NA
Indica II	465	5.60%	32.00%	11.61%	50.75%	NA
Indica III	913	1.50%	44.20%	8.21%	46.00%	NA
Indica Intermediate	786	4.50%	45.50%	14.89%	35.11%	NA
Temperate Japonica	767	97.00%	0.90%	1.69%	0.39%	NA
Tropical Japonica	504	89.30%	0.20%	9.72%	0.79%	NA
Japonica Intermediate	241	98.30%	0.40%	0.83%	0.41%	NA
VI/Aromatic	96	76.00%	9.40%	11.46%	3.12%	NA
Intermediate	90	44.40%	25.60%	12.22%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709350055	A -> DEL	N	N	silent_mutation	Average:30.553; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0709350055	A -> G	LOC_Os07g16040.1	upstream_gene_variant ; 2986.0bp to feature; MODIFIER	silent_mutation	Average:30.553; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0709350055	A -> G	LOC_Os07g16030.1	downstream_gene_variant ; 592.0bp to feature; MODIFIER	silent_mutation	Average:30.553; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0709350055	A -> G	LOC_Os07g16030-LOC_Os07g16040	intergenic_region ; MODIFIER	silent_mutation	Average:30.553; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709350055	4.15E-06	NA	mr1150	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709350055	NA	4.36E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709350055	NA	1.85E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709350055	NA	4.60E-37	mr1224_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709350055	NA	1.34E-26	mr1270_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709350055	NA	1.50E-22	mr1316_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709350055	NA	9.37E-14	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709350055	NA	2.63E-14	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709350055	NA	2.00E-08	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709350055	NA	2.24E-15	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251