| Variant ID: vg0709350055 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9350055 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.17, others allele: 0.00, population size: 86. )
GTTCCACAAGATATATCGGAATTATTTCACTAAGTAGATCGAAAATGTTTCACTCGTTTAAATCGGGTGTTGTTTCACCTTATATAAAAACAATGTTTCA[A/G]
TAAATAGTGAAAGAATGTTTCAATTCACTGCAACATTAGATCTATACATAGTGAAACATTGTGAGTACACTAGGTGAAACATTTTTCGGTGGAACAAAAA
TTTTTGTTCCACCGAAAAATGTTTCACCTAGTGTACTCACAATGTTTCACTATGTATAGATCTAATGTTGCAGTGAATTGAAACATTCTTTCACTATTTA[T/C]
TGAAACATTGTTTTTATATAAGGTGAAACAACACCCGATTTAAACGAGTGAAACATTTTCGATCTACTTAGTGAAATAATTCCGATATATCTTGTGGAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.20% | 31.00% | 7.98% | 22.87% | NA |
| All Indica | 2759 | 3.20% | 49.00% | 10.22% | 37.66% | NA |
| All Japonica | 1512 | 94.60% | 0.60% | 4.23% | 0.53% | NA |
| Aus | 269 | 64.30% | 26.80% | 3.35% | 5.58% | NA |
| Indica I | 595 | 2.00% | 73.90% | 6.05% | 17.98% | NA |
| Indica II | 465 | 5.60% | 32.00% | 11.61% | 50.75% | NA |
| Indica III | 913 | 1.50% | 44.20% | 8.21% | 46.00% | NA |
| Indica Intermediate | 786 | 4.50% | 45.50% | 14.89% | 35.11% | NA |
| Temperate Japonica | 767 | 97.00% | 0.90% | 1.69% | 0.39% | NA |
| Tropical Japonica | 504 | 89.30% | 0.20% | 9.72% | 0.79% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 76.00% | 9.40% | 11.46% | 3.12% | NA |
| Intermediate | 90 | 44.40% | 25.60% | 12.22% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709350055 | A -> DEL | N | N | silent_mutation | Average:30.553; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0709350055 | A -> G | LOC_Os07g16040.1 | upstream_gene_variant ; 2986.0bp to feature; MODIFIER | silent_mutation | Average:30.553; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0709350055 | A -> G | LOC_Os07g16030.1 | downstream_gene_variant ; 592.0bp to feature; MODIFIER | silent_mutation | Average:30.553; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0709350055 | A -> G | LOC_Os07g16030-LOC_Os07g16040 | intergenic_region ; MODIFIER | silent_mutation | Average:30.553; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709350055 | 4.15E-06 | NA | mr1150 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709350055 | NA | 4.36E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709350055 | NA | 1.85E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709350055 | NA | 4.60E-37 | mr1224_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709350055 | NA | 1.34E-26 | mr1270_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709350055 | NA | 1.50E-22 | mr1316_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709350055 | NA | 9.37E-14 | mr1326_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709350055 | NA | 2.63E-14 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709350055 | NA | 2.00E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709350055 | NA | 2.24E-15 | mr1686_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |