Variant ID: vg0709269240 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 9269240 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAATTGACGGTAGTGGCATGAGAGGGTGCGCAAATTTGGACCAATGGCATATAAGGGAAGAGCCAATTTTCAGTGGCATATAAGGGATCAAACCAATTTT[C/T]
AGTGGCATATAAGGGATTATCTCAAAAAAAAAATGCCCAAGGAGCTAGCTGTGGGTATGTGTTCGGGAACCCTCGCTCCCTTCCCTAGCTCGTGAAACAA
TTGTTTCACGAGCTAGGGAAGGGAGCGAGGGTTCCCGAACACATACCCACAGCTAGCTCCTTGGGCATTTTTTTTTTGAGATAATCCCTTATATGCCACT[G/A]
AAAATTGGTTTGATCCCTTATATGCCACTGAAAATTGGCTCTTCCCTTATATGCCATTGGTCCAAATTTGCGCACCCTCTCATGCCACTACCGTCAATTG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 87.20% | 12.80% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 82.50% | 17.50% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0709269240 | C -> T | LOC_Os07g15950.1 | upstream_gene_variant ; 2535.0bp to feature; MODIFIER | silent_mutation | Average:40.856; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
vg0709269240 | C -> T | LOC_Os07g15950-LOC_Os07g15959 | intergenic_region ; MODIFIER | silent_mutation | Average:40.856; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0709269240 | 2.63E-06 | 1.85E-15 | mr1549 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709269240 | 1.63E-06 | 1.37E-08 | mr1550 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709269240 | NA | 6.87E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709269240 | 1.72E-07 | 1.27E-16 | mr1757 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709269240 | NA | 2.28E-08 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709269240 | NA | 7.73E-07 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709269240 | NA | 3.53E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709269240 | NA | 3.05E-09 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |