Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0709266953:

Variant ID: vg0709266953 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 9266953
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TCGAGGGGGGGTAATTTGTGCATTATTGAAAGTTGAGGGTGAACGATGTCTGGTTTCTGGGATGAGGGGGGTAATTCGGTTGACCACGATAGTTCCGAGG[G/A]
GAGGGTAATTCGTACTTTTTCCTTTCTTTTTCAGATGTGCATATGCATATTTCCATGTACTTGCTGAGTATTTCATGTAATCACCACACAATTGCCCCAA

Reverse complement sequence

TTGGGGCAATTGTGTGGTGATTACATGAAATACTCAGCAAGTACATGGAAATATGCATATGCACATCTGAAAAAGAAAGGAAAAAGTACGAATTACCCTC[C/T]
CCTCGGAACTATCGTGGTCAACCGAATTACCCCCCTCATCCCAGAAACCAGACATCGTTCACCCTCAACTTTCAATAATGCACAAATTACCCCCCCTCGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.60%	4.30%	0.11%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	87.20%	12.60%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	82.70%	16.90%	0.39%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	77.20%	22.80%	0.00%	0.00%	NA
VI/Aromatic	96	82.30%	15.60%	2.08%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0709266953	G -> A	LOC_Os07g15940.1	upstream_gene_variant ; 4123.0bp to feature; MODIFIER	silent_mutation	Average:62.088; most accessible tissue: Callus, score: 82.37	N	N	N	N
vg0709266953	G -> A	LOC_Os07g15950.1	upstream_gene_variant ; 248.0bp to feature; MODIFIER	silent_mutation	Average:62.088; most accessible tissue: Callus, score: 82.37	N	N	N	N
vg0709266953	G -> A	LOC_Os07g15950-LOC_Os07g15959	intergenic_region ; MODIFIER	silent_mutation	Average:62.088; most accessible tissue: Callus, score: 82.37	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0709266953	1.10E-07	NA	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709266953	NA	1.46E-15	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709266953	6.95E-06	6.33E-08	mr1550	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709266953	NA	5.12E-08	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709266953	4.19E-08	NA	mr1757	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709266953	3.09E-06	6.68E-16	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709266953	NA	5.96E-09	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709266953	NA	5.83E-07	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709266953	NA	2.08E-06	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709266953	NA	4.54E-10	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251