Variant ID: vg0709266953 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 9266953 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 277. )
TCGAGGGGGGGTAATTTGTGCATTATTGAAAGTTGAGGGTGAACGATGTCTGGTTTCTGGGATGAGGGGGGTAATTCGGTTGACCACGATAGTTCCGAGG[G/A]
GAGGGTAATTCGTACTTTTTCCTTTCTTTTTCAGATGTGCATATGCATATTTCCATGTACTTGCTGAGTATTTCATGTAATCACCACACAATTGCCCCAA
TTGGGGCAATTGTGTGGTGATTACATGAAATACTCAGCAAGTACATGGAAATATGCATATGCACATCTGAAAAAGAAAGGAAAAAGTACGAATTACCCTC[C/T]
CCTCGGAACTATCGTGGTCAACCGAATTACCCCCCTCATCCCAGAAACCAGACATCGTTCACCCTCAACTTTCAATAATGCACAAATTACCCCCCCTCGA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 95.60% | 4.30% | 0.11% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 87.20% | 12.60% | 0.20% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 82.70% | 16.90% | 0.39% | 0.00% | NA |
Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 82.30% | 15.60% | 2.08% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0709266953 | G -> A | LOC_Os07g15940.1 | upstream_gene_variant ; 4123.0bp to feature; MODIFIER | silent_mutation | Average:62.088; most accessible tissue: Callus, score: 82.37 | N | N | N | N |
vg0709266953 | G -> A | LOC_Os07g15950.1 | upstream_gene_variant ; 248.0bp to feature; MODIFIER | silent_mutation | Average:62.088; most accessible tissue: Callus, score: 82.37 | N | N | N | N |
vg0709266953 | G -> A | LOC_Os07g15950-LOC_Os07g15959 | intergenic_region ; MODIFIER | silent_mutation | Average:62.088; most accessible tissue: Callus, score: 82.37 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0709266953 | 1.10E-07 | NA | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709266953 | NA | 1.46E-15 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709266953 | 6.95E-06 | 6.33E-08 | mr1550 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709266953 | NA | 5.12E-08 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709266953 | 4.19E-08 | NA | mr1757 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709266953 | 3.09E-06 | 6.68E-16 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709266953 | NA | 5.96E-09 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709266953 | NA | 5.83E-07 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709266953 | NA | 2.08E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0709266953 | NA | 4.54E-10 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |