Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0709159938:

Variant ID: vg0709159938 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9159938
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.55, C: 0.45, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


AAAACAAAACAAATCCGAATTTTCCTGTAGCAAAACAAAACTGCAAAAGGAAGCTGCATCTGCGCAAGGGTGAGGAGCCAATTTTGCGGATCATTCGACG[T/C]
GTACGTCGTGCACGCGCGCCGCCAGCCCTGCCCTGCTAGGCCAGGCGAGGCGAGTGAGCGCGCGCGCGTGTTTTCCCCCTTCTCTCCACCACACATGCTT

Reverse complement sequence

AAGCATGTGTGGTGGAGAGAAGGGGGAAAACACGCGCGCGCGCTCACTCGCCTCGCCTGGCCTAGCAGGGCAGGGCTGGCGGCGCGCGTGCACGACGTAC[A/G]
CGTCGAATGATCCGCAAAATTGGCTCCTCACCCTTGCGCAGATGCAGCTTCCTTTTGCAGTTTTGTTTTGCTACAGGAAAATTCGGATTTGTTTTGTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 36.80% 0.61% 12.44% NA
All Indica  2759 76.30% 2.60% 0.91% 20.19% NA
All Japonica  1512 6.10% 92.20% 0.00% 1.72% NA
Aus  269 34.20% 65.40% 0.37% 0.00% NA
Indica I  595 29.90% 2.50% 2.86% 64.71% NA
Indica II  465 89.00% 4.10% 0.43% 6.45% NA
Indica III  913 99.30% 0.10% 0.22% 0.33% NA
Indica Intermediate  786 77.10% 4.70% 0.51% 17.68% NA
Temperate Japonica  767 3.50% 94.10% 0.00% 2.35% NA
Tropical Japonica  504 11.70% 88.30% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 94.20% 0.00% 3.32% NA
VI/Aromatic  96 36.50% 63.50% 0.00% 0.00% NA
Intermediate  90 48.90% 42.20% 3.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709159938 T -> DEL N N silent_mutation Average:35.018; most accessible tissue: Minghui63 flag leaf, score: 78.154 N N N N
vg0709159938 T -> C LOC_Os07g15770.1 upstream_gene_variant ; 4753.0bp to feature; MODIFIER silent_mutation Average:35.018; most accessible tissue: Minghui63 flag leaf, score: 78.154 N N N N
vg0709159938 T -> C LOC_Os07g15780.1 downstream_gene_variant ; 903.0bp to feature; MODIFIER silent_mutation Average:35.018; most accessible tissue: Minghui63 flag leaf, score: 78.154 N N N N
vg0709159938 T -> C LOC_Os07g15770-LOC_Os07g15780 intergenic_region ; MODIFIER silent_mutation Average:35.018; most accessible tissue: Minghui63 flag leaf, score: 78.154 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709159938 NA 3.22E-13 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0709159938 NA 7.63E-08 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0709159938 NA 7.98E-06 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 3.11E-07 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 5.48E-16 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 2.48E-11 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 1.85E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 4.41E-06 mr1322 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 4.75E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 4.05E-14 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 3.96E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 6.81E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 2.84E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 4.42E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 1.28E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 1.94E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 1.65E-10 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 3.05E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 2.56E-61 mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 5.28E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 4.52E-06 6.47E-07 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 6.44E-54 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 5.53E-07 9.35E-07 mr1245_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 1.13E-26 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 4.63E-06 4.63E-06 mr1284_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 1.95E-23 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 4.99E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 4.37E-10 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 9.54E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 3.69E-06 6.33E-06 mr1371_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 1.18E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 9.02E-11 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 4.88E-06 NA mr1397_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 7.03E-06 7.03E-06 mr1417_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 4.49E-06 5.71E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 1.76E-08 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 1.11E-06 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 1.51E-06 mr1616_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 6.69E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 3.61E-06 1.10E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 1.22E-06 1.22E-06 mr1651_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 5.07E-06 5.07E-06 mr1652_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 3.55E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 5.50E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 2.63E-06 5.51E-06 mr1655_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 4.51E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 5.08E-07 6.65E-08 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 5.32E-06 1.71E-07 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 9.22E-06 9.22E-06 mr1697_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 2.89E-08 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 1.84E-07 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 9.51E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709159938 NA 1.83E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251