\
| Variant ID: vg0709033301 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 9033301 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTAGAGACATAGATGACACACATGCATAAGTTTGGAGGCTATTTGTGCACTTTACTCTTTCTTATAATATTTTTTTCTAATTTATTAGAGCGTTACATAA[C/T]
GATTTAGGAGCGTGTACAAGATGTTTAACGAAGTCATAGTATATAATAGATAGACAAATAAATAAATACTACTATATATCTTATAGGTGGAAGACATGCA
TGCATGTCTTCCACCTATAAGATATATAGTAGTATTTATTTATTTGTCTATCTATTATATACTATGACTTCGTTAAACATCTTGTACACGCTCCTAAATC[G/A]
TTATGTAACGCTCTAATAAATTAGAAAAAAATATTATAAGAAAGAGTAAAGTGCACAAATAGCCTCCAAACTTATGCATGTGTGTCATCTATGTCTCTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.00% | 3.40% | 0.55% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.40% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 0.50% | 0.60% | 0.00% | NA |
| Aus | 269 | 41.30% | 53.20% | 5.58% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 0.20% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0709033301 | C -> T | LOC_Os07g15580.1 | upstream_gene_variant ; 3782.0bp to feature; MODIFIER | silent_mutation | Average:43.023; most accessible tissue: Callus, score: 73.014 | N | N | N | N |
| vg0709033301 | C -> T | LOC_Os07g15600.1 | downstream_gene_variant ; 2659.0bp to feature; MODIFIER | silent_mutation | Average:43.023; most accessible tissue: Callus, score: 73.014 | N | N | N | N |
| vg0709033301 | C -> T | LOC_Os07g15590.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.023; most accessible tissue: Callus, score: 73.014 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0709033301 | NA | 1.33E-16 | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709033301 | NA | 8.53E-38 | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709033301 | 4.58E-06 | NA | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709033301 | NA | 1.36E-16 | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709033301 | 7.17E-06 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709033301 | 1.95E-08 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709033301 | 8.25E-06 | 8.88E-18 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709033301 | 1.98E-07 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709033301 | 2.29E-07 | NA | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709033301 | 9.06E-06 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709033301 | NA | 6.76E-08 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709033301 | NA | 5.71E-31 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709033301 | NA | 5.26E-47 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709033301 | NA | 3.08E-29 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709033301 | NA | 1.74E-06 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0709033301 | 4.69E-08 | 5.75E-15 | mr1936_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |