\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0709019375:

Variant ID: vg0709019375 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 9019375
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACGGGGAGGAGAGGCTGAGCCGTTGGATTCGTTGAATTGATAGATGGACGGTAGGATTTAACTGGTTGATTTCACCTGTAGGATTGGAGGGGGCAACTC[C/T]
TTCTTTTTATATTAGTATAGAAATTGGTTATTAGATCGGTTATAGGTGAATTGGAGCTTGTAATGGGCTATACTATTAAACTTGCTCTTATATCGAACTA

Reverse complement sequence

TAGTTCGATATAAGAGCAAGTTTAATAGTATAGCCCATTACAAGCTCCAATTCACCTATAACCGATCTAATAACCAATTTCTATACTAATATAAAAAGAA[G/A]
GAGTTGCCCCCTCCAATCCTACAGGTGAAATCAACCAGTTAAATCCTACCGTCCATCTATCAATTCAACGAATCCAACGGCTCAGCCTCTCCTCCCCGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 11.00% 0.80% 0.00% NA
All Indica  2759 99.50% 0.40% 0.04% 0.00% NA
All Japonica  1512 74.90% 23.40% 1.72% 0.00% NA
Aus  269 41.60% 54.60% 3.72% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 98.80% 0.40% 0.78% 0.00% NA
Tropical Japonica  504 30.20% 66.50% 3.37% 0.00% NA
Japonica Intermediate  241 92.10% 6.60% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0709019375 C -> T LOC_Os07g15570.1 upstream_gene_variant ; 2909.0bp to feature; MODIFIER silent_mutation Average:66.563; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0709019375 C -> T LOC_Os07g15550.1 downstream_gene_variant ; 4457.0bp to feature; MODIFIER silent_mutation Average:66.563; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0709019375 C -> T LOC_Os07g15560.1 downstream_gene_variant ; 928.0bp to feature; MODIFIER silent_mutation Average:66.563; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0709019375 C -> T LOC_Os07g15560-LOC_Os07g15570 intergenic_region ; MODIFIER silent_mutation Average:66.563; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0709019375 NA 2.83E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 NA 3.04E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 NA 1.60E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 3.63E-06 NA mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 6.27E-07 6.27E-07 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 9.04E-09 NA mr1082_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 5.54E-07 3.59E-08 mr1082_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 6.94E-10 NA mr1083_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 1.61E-07 1.60E-09 mr1083_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 3.62E-10 NA mr1104_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 2.30E-07 NA mr1104_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 6.26E-08 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 5.98E-06 NA mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 6.78E-08 NA mr1145_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 4.63E-06 NA mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 1.69E-06 NA mr1155_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 3.43E-07 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 4.57E-06 1.05E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 8.76E-06 NA mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 5.71E-08 NA mr1408_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 4.69E-07 3.97E-09 mr1408_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0709019375 NA 1.42E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251