| Variant ID: vg0707896183 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 7896183 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACATGGAAGCCGATTGATGGAACAGATGTAGCTTCCACTCGCCCCACCATCTATCAAATGCCCTACTCCTGAGTCTTGCTAACTTTATGTTTTCAATGCT[G/T]
CCTAATGGGGGTCCAGGGATGTTCAGTAGCCGATCCATCATCAAGGTTGAAGAGATATTGCCTCTACACTGGATCTTGTCGGTGAAGTACAGGCCGATTA
TAATCGGCCTGTACTTCACCGACAAGATCCAGTGTAGAGGCAATATCTCTTCAACCTTGATGATGGATCGGCTACTGAACATCCCTGGACCCCCATTAGG[C/A]
AGCATTGAAAACATAAAGTTAGCAAGACTCAGGAGTAGGGCATTTGATAGATGGTGGGGCGAGTGGAAGCTACATCTGTTCCATCAATCGGCTTCCATGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 1.60% | 4.93% | 5.48% | NA |
| All Indica | 2759 | 81.30% | 2.70% | 8.23% | 7.79% | NA |
| All Japonica | 1512 | 98.70% | 0.00% | 0.07% | 1.26% | NA |
| Aus | 269 | 92.90% | 0.00% | 0.74% | 6.32% | NA |
| Indica I | 595 | 71.80% | 5.50% | 15.63% | 7.06% | NA |
| Indica II | 465 | 80.00% | 3.00% | 8.82% | 8.17% | NA |
| Indica III | 913 | 86.40% | 0.50% | 5.04% | 8.00% | NA |
| Indica Intermediate | 786 | 83.30% | 2.80% | 5.98% | 7.89% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 97.00% | 0.00% | 0.20% | 2.78% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 0.00% | 3.33% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0707896183 | G -> DEL | LOC_Os07g13760.1 | N | frameshift_variant | Average:13.662; most accessible tissue: Callus, score: 44.674 | N | N | N | N |
| vg0707896183 | G -> T | LOC_Os07g13760.1 | synonymous_variant ; p.Gly340Gly; LOW | synonymous_codon | Average:13.662; most accessible tissue: Callus, score: 44.674 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0707896183 | NA | 2.17E-08 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707896183 | NA | 1.06E-06 | mr1402_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707896183 | NA | 4.32E-06 | mr1415_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707896183 | 8.19E-06 | 8.19E-06 | mr1584_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707896183 | NA | 5.65E-06 | mr1763_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707896183 | NA | 5.15E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707896183 | 3.43E-06 | NA | mr1942_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |