\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707873071:

Variant ID: vg0707873071 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 7873071
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGCCAATATACGCCAAGACATGCTGCCGGATATCGACTTCAGGGATAGGCATGAATATTCCCCTACGGTGTCTCCGGATACCGTCAGGAGATACGAAAG[C/A]
GCTAACTCTGATCTCGCCGGGCACAGATCTGAGGAGGAAGACTACCCTGTTGTCGACTACGAGTTATACCTTTAGACCAACATGTCGACAACAGTTAGAT

Reverse complement sequence

ATCTAACTGTTGTCGACATGTTGGTCTAAAGGTATAACTCGTAGTCGACAACAGGGTAGTCTTCCTCCTCAGATCTGTGCCCGGCGAGATCAGAGTTAGC[G/T]
CTTTCGTATCTCCTGACGGTATCCGGAGACACCGTAGGGGAATATTCATGCCTATCCCTGAAGTCGATATCCGGCAGCATGTCTTGGCGTATATTGGCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.20% 7.60% 0.83% 4.36% NA
All Indica  2759 91.50% 0.30% 0.83% 7.32% NA
All Japonica  1512 90.50% 8.90% 0.60% 0.00% NA
Aus  269 45.40% 53.50% 1.12% 0.00% NA
Indica I  595 98.70% 0.00% 0.84% 0.50% NA
Indica II  465 91.80% 0.00% 1.51% 6.67% NA
Indica III  913 89.30% 0.00% 0.77% 9.97% NA
Indica Intermediate  786 88.50% 1.10% 0.51% 9.80% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 79.80% 19.40% 0.79% 0.00% NA
Japonica Intermediate  241 83.80% 14.10% 2.07% 0.00% NA
VI/Aromatic  96 30.20% 66.70% 3.12% 0.00% NA
Intermediate  90 86.70% 7.80% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707873071 C -> DEL N N silent_mutation Average:56.23; most accessible tissue: Minghui63 young leaf, score: 75.937 N N N N
vg0707873071 C -> A LOC_Os07g13710.1 upstream_gene_variant ; 425.0bp to feature; MODIFIER silent_mutation Average:56.23; most accessible tissue: Minghui63 young leaf, score: 75.937 N N N N
vg0707873071 C -> A LOC_Os07g13719.1 upstream_gene_variant ; 521.0bp to feature; MODIFIER silent_mutation Average:56.23; most accessible tissue: Minghui63 young leaf, score: 75.937 N N N N
vg0707873071 C -> A LOC_Os07g13728.1 upstream_gene_variant ; 3875.0bp to feature; MODIFIER silent_mutation Average:56.23; most accessible tissue: Minghui63 young leaf, score: 75.937 N N N N
vg0707873071 C -> A LOC_Os07g13710-LOC_Os07g13719 intergenic_region ; MODIFIER silent_mutation Average:56.23; most accessible tissue: Minghui63 young leaf, score: 75.937 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707873071 NA 1.01E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707873071 NA 3.86E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707873071 1.37E-06 1.31E-08 mr1083 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707873071 NA 9.00E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707873071 NA 8.86E-08 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707873071 NA 1.29E-08 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707873071 NA 1.68E-06 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707873071 NA 2.16E-06 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251