\
| Variant ID: vg0707873071 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 7873071 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAGCCAATATACGCCAAGACATGCTGCCGGATATCGACTTCAGGGATAGGCATGAATATTCCCCTACGGTGTCTCCGGATACCGTCAGGAGATACGAAAG[C/A]
GCTAACTCTGATCTCGCCGGGCACAGATCTGAGGAGGAAGACTACCCTGTTGTCGACTACGAGTTATACCTTTAGACCAACATGTCGACAACAGTTAGAT
ATCTAACTGTTGTCGACATGTTGGTCTAAAGGTATAACTCGTAGTCGACAACAGGGTAGTCTTCCTCCTCAGATCTGTGCCCGGCGAGATCAGAGTTAGC[G/T]
CTTTCGTATCTCCTGACGGTATCCGGAGACACCGTAGGGGAATATTCATGCCTATCCCTGAAGTCGATATCCGGCAGCATGTCTTGGCGTATATTGGCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.20% | 7.60% | 0.83% | 4.36% | NA |
| All Indica | 2759 | 91.50% | 0.30% | 0.83% | 7.32% | NA |
| All Japonica | 1512 | 90.50% | 8.90% | 0.60% | 0.00% | NA |
| Aus | 269 | 45.40% | 53.50% | 1.12% | 0.00% | NA |
| Indica I | 595 | 98.70% | 0.00% | 0.84% | 0.50% | NA |
| Indica II | 465 | 91.80% | 0.00% | 1.51% | 6.67% | NA |
| Indica III | 913 | 89.30% | 0.00% | 0.77% | 9.97% | NA |
| Indica Intermediate | 786 | 88.50% | 1.10% | 0.51% | 9.80% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 79.80% | 19.40% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.80% | 14.10% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 30.20% | 66.70% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 7.80% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0707873071 | C -> DEL | N | N | silent_mutation | Average:56.23; most accessible tissue: Minghui63 young leaf, score: 75.937 | N | N | N | N |
| vg0707873071 | C -> A | LOC_Os07g13710.1 | upstream_gene_variant ; 425.0bp to feature; MODIFIER | silent_mutation | Average:56.23; most accessible tissue: Minghui63 young leaf, score: 75.937 | N | N | N | N |
| vg0707873071 | C -> A | LOC_Os07g13719.1 | upstream_gene_variant ; 521.0bp to feature; MODIFIER | silent_mutation | Average:56.23; most accessible tissue: Minghui63 young leaf, score: 75.937 | N | N | N | N |
| vg0707873071 | C -> A | LOC_Os07g13728.1 | upstream_gene_variant ; 3875.0bp to feature; MODIFIER | silent_mutation | Average:56.23; most accessible tissue: Minghui63 young leaf, score: 75.937 | N | N | N | N |
| vg0707873071 | C -> A | LOC_Os07g13710-LOC_Os07g13719 | intergenic_region ; MODIFIER | silent_mutation | Average:56.23; most accessible tissue: Minghui63 young leaf, score: 75.937 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0707873071 | NA | 1.01E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707873071 | NA | 3.86E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707873071 | 1.37E-06 | 1.31E-08 | mr1083 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707873071 | NA | 9.00E-06 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707873071 | NA | 8.86E-08 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707873071 | NA | 1.29E-08 | mr1735 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707873071 | NA | 1.68E-06 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707873071 | NA | 2.16E-06 | mr1819 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |