\
| Variant ID: vg0707768545 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 7768545 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TACAACACAAAGGGAAAAAATGTTCATTGCTTTAAGTAGAACTGCATACCAAATTGGGTTTAGCCAAGTCATCGCCATACGTTGGTACAGTCGTGGCCGA[G/A]
CCACCGCTCCCAATCTCCCTTCTCGTCCCCGGCGTCCTAACCATCGCTCGGACCTGGCACTGAACGAAGCAGAGAGCGATTGGAATAGGGCGAGGGAGAG
CTCTCCCTCGCCCTATTCCAATCGCTCTCTGCTTCGTTCAGTGCCAGGTCCGAGCGATGGTTAGGACGCCGGGGACGAGAAGGGAGATTGGGAGCGGTGG[C/T]
TCGGCCACGACTGTACCAACGTATGGCGATGACTTGGCTAAACCCAATTTGGTATGCAGTTCTACTTAAAGCAATGAACATTTTTTCCCTTTGTGTTGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.00% | 1.50% | 1.44% | 0.00% | NA |
| All Indica | 2759 | 95.00% | 2.60% | 2.43% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.10% | 2.00% | 6.89% | 0.00% | NA |
| Indica II | 465 | 96.80% | 2.20% | 1.08% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.70% | 5.60% | 2.67% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0707768545 | G -> A | LOC_Os07g13560.1 | upstream_gene_variant ; 4461.0bp to feature; MODIFIER | silent_mutation | Average:64.423; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| vg0707768545 | G -> A | LOC_Os07g13550.1 | downstream_gene_variant ; 790.0bp to feature; MODIFIER | silent_mutation | Average:64.423; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| vg0707768545 | G -> A | LOC_Os07g13550-LOC_Os07g13560 | intergenic_region ; MODIFIER | silent_mutation | Average:64.423; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0707768545 | 8.08E-09 | 7.07E-13 | mr1155 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707768545 | 6.74E-06 | 2.74E-06 | mr1408 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707768545 | NA | 4.08E-06 | mr1409 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707768545 | NA | 5.27E-08 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |