\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707768545:

Variant ID: vg0707768545 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 7768545
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACAACACAAAGGGAAAAAATGTTCATTGCTTTAAGTAGAACTGCATACCAAATTGGGTTTAGCCAAGTCATCGCCATACGTTGGTACAGTCGTGGCCGA[G/A]
CCACCGCTCCCAATCTCCCTTCTCGTCCCCGGCGTCCTAACCATCGCTCGGACCTGGCACTGAACGAAGCAGAGAGCGATTGGAATAGGGCGAGGGAGAG

Reverse complement sequence

CTCTCCCTCGCCCTATTCCAATCGCTCTCTGCTTCGTTCAGTGCCAGGTCCGAGCGATGGTTAGGACGCCGGGGACGAGAAGGGAGATTGGGAGCGGTGG[C/T]
TCGGCCACGACTGTACCAACGTATGGCGATGACTTGGCTAAACCCAATTTGGTATGCAGTTCTACTTAAAGCAATGAACATTTTTTCCCTTTGTGTTGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.00% 1.50% 1.44% 0.00% NA
All Indica  2759 95.00% 2.60% 2.43% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.10% 2.00% 6.89% 0.00% NA
Indica II  465 96.80% 2.20% 1.08% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 91.70% 5.60% 2.67% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707768545 G -> A LOC_Os07g13560.1 upstream_gene_variant ; 4461.0bp to feature; MODIFIER silent_mutation Average:64.423; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg0707768545 G -> A LOC_Os07g13550.1 downstream_gene_variant ; 790.0bp to feature; MODIFIER silent_mutation Average:64.423; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg0707768545 G -> A LOC_Os07g13550-LOC_Os07g13560 intergenic_region ; MODIFIER silent_mutation Average:64.423; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707768545 8.08E-09 7.07E-13 mr1155 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707768545 6.74E-06 2.74E-06 mr1408 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707768545 NA 4.08E-06 mr1409 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707768545 NA 5.27E-08 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251