\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707667722:

Variant ID: vg0707667722 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 7667722
Reference Allele: CATGAGAlternative Allele: TATGAG,C
Primary Allele: CATGAGSecondary Allele: TATGAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTATTAACCAATTGGTACTCATGCCTAACAACTCAGGGGTAAATATGTCTTTTCACGTTCAAGTTAGCAGTCAACGTACGGTCAGCTCACGGGAGTGG[CATGAG/TATGAG,C]
AGGGTACGCAAATTTAAGCTAATGGCATATAAGGGAAGAACCAATTTTGTTTGGCAATCAGGGATCGGACCAAATTTCAGTGGCATATAAGGGATTCTCT

Reverse complement sequence

AGAGAATCCCTTATATGCCACTGAAATTTGGTCCGATCCCTGATTGCCAAACAAAATTGGTTCTTCCCTTATATGCCATTAGCTTAAATTTGCGTACCCT[CTCATG/CTCATA,G]
CCACTCCCGTGAGCTGACCGTACGTTGACTGCTAACTTGAACGTGAAAAGACATATTTACCCCTGAGTTGTTAGGCATGAGTACCAATTGGTTAATAAAA

Allele Frequencies:

Populations Population SizeFrequency of CATGAG(primary allele) Frequency of TATGAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.70% 6.60% 0.13% 0.00% C: 0.55%
All Indica  2759 99.70% 0.30% 0.00% 0.00% C: 0.04%
All Japonica  1512 80.40% 19.40% 0.20% 0.00% NA
Aus  269 89.60% 0.00% 1.12% 0.00% C: 9.29%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.00% 0.00% C: 0.13%
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 42.90% 56.50% 0.60% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707667722 CATGAG -> TATGAG LOC_Os07g13350.1 upstream_gene_variant ; 3348.0bp to feature; MODIFIER silent_mutation Average:76.851; most accessible tissue: Callus, score: 97.826 N N N N
vg0707667722 CATGAG -> TATGAG LOC_Os07g13360.1 downstream_gene_variant ; 620.0bp to feature; MODIFIER silent_mutation Average:76.851; most accessible tissue: Callus, score: 97.826 N N N N
vg0707667722 CATGAG -> TATGAG LOC_Os07g13370.1 downstream_gene_variant ; 639.0bp to feature; MODIFIER silent_mutation Average:76.851; most accessible tissue: Callus, score: 97.826 N N N N
vg0707667722 CATGAG -> TATGAG LOC_Os07g13380.1 downstream_gene_variant ; 2319.0bp to feature; MODIFIER silent_mutation Average:76.851; most accessible tissue: Callus, score: 97.826 N N N N
vg0707667722 CATGAG -> TATGAG LOC_Os07g13360-LOC_Os07g13370 intergenic_region ; MODIFIER silent_mutation Average:76.851; most accessible tissue: Callus, score: 97.826 N N N N
vg0707667722 CATGAG -> C LOC_Os07g13350.1 upstream_gene_variant ; 3349.0bp to feature; MODIFIER silent_mutation Average:76.851; most accessible tissue: Callus, score: 97.826 N N N N
vg0707667722 CATGAG -> C LOC_Os07g13360.1 downstream_gene_variant ; 621.0bp to feature; MODIFIER silent_mutation Average:76.851; most accessible tissue: Callus, score: 97.826 N N N N
vg0707667722 CATGAG -> C LOC_Os07g13370.1 downstream_gene_variant ; 638.0bp to feature; MODIFIER silent_mutation Average:76.851; most accessible tissue: Callus, score: 97.826 N N N N
vg0707667722 CATGAG -> C LOC_Os07g13380.1 downstream_gene_variant ; 2318.0bp to feature; MODIFIER silent_mutation Average:76.851; most accessible tissue: Callus, score: 97.826 N N N N
vg0707667722 CATGAG -> C LOC_Os07g13360-LOC_Os07g13370 intergenic_region ; MODIFIER silent_mutation Average:76.851; most accessible tissue: Callus, score: 97.826 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707667722 1.28E-10 NA mr1076 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 NA 1.37E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 2.00E-10 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 NA 5.31E-08 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 4.92E-10 NA mr1083 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 NA 8.52E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 1.44E-07 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 6.42E-07 NA mr1086 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 8.86E-07 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 4.58E-09 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 2.99E-07 NA mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 NA 9.30E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 2.08E-13 NA mr1226 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 NA 9.30E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 NA 1.57E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 1.11E-08 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 3.01E-07 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 4.49E-06 9.09E-12 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 1.78E-06 NA mr1070_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 5.51E-07 5.51E-07 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 1.30E-15 NA mr1082_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 NA 1.11E-08 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 4.32E-16 NA mr1083_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 NA 1.61E-08 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 2.50E-09 NA mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 2.31E-11 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 3.19E-14 NA mr1104_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 4.38E-14 NA mr1107_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 2.07E-08 NA mr1145_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 7.72E-06 NA mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 1.02E-14 NA mr1226_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 NA 3.41E-08 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 1.63E-08 2.82E-14 mr1408_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 2.59E-06 NA mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 NA 3.85E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707667722 6.18E-06 NA mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251