\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707344915:

Variant ID: vg0707344915 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 7344915
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.13, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


AACAATGTTACTATCACTTTGTCGGATGAAGAAACAACCAAAATAAAAGTTATAGATCTTGATGAGTTATAAAACTTTGTTGTTGATAACTTTTTCAGTT[G/A,C]
AAATCATTAATATTTTAAAATATTGTTTGAAGTTGTTATATTTTGAAATTCAAATTCAAACGGTTCAAACAAAGTCATATAGAAAAATGACCAAAATAAA

Reverse complement sequence

TTTATTTTGGTCATTTTTCTATATGACTTTGTTTGAACCGTTTGAATTTGAATTTCAAAATATAACAACTTCAAACAATATTTTAAAATATTAATGATTT[C/T,G]
AACTGAAAAAGTTATCAACAACAAAGTTTTATAACTCATCAAGATCTATAACTTTTATTTTGGTTGTTTCTTCATCCGACAAAGTGATAGTAACATTGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.40% 5.40% 28.57% 26.81% C: 2.86%
All Indica  2759 8.30% 8.50% 38.20% 43.13% C: 1.85%
All Japonica  1512 79.20% 1.00% 16.40% 3.44% NA
Aus  269 65.80% 0.00% 2.97% 2.60% C: 28.62%
Indica I  595 2.90% 4.70% 34.12% 58.32% NA
Indica II  465 10.50% 7.70% 30.54% 51.18% NA
Indica III  913 4.80% 13.30% 50.60% 30.23% C: 1.10%
Indica Intermediate  786 15.10% 6.40% 31.42% 41.86% C: 5.22%
Temperate Japonica  767 95.80% 0.00% 2.35% 1.83% NA
Tropical Japonica  504 67.10% 2.00% 28.37% 2.58% NA
Japonica Intermediate  241 51.50% 2.10% 36.10% 10.37% NA
VI/Aromatic  96 78.10% 0.00% 19.79% 0.00% C: 2.08%
Intermediate  90 47.80% 3.30% 23.33% 20.00% C: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707344915 G -> DEL N N silent_mutation Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0707344915 G -> A LOC_Os07g12830.1 upstream_gene_variant ; 2839.0bp to feature; MODIFIER silent_mutation Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0707344915 G -> A LOC_Os07g12830.2 upstream_gene_variant ; 2891.0bp to feature; MODIFIER silent_mutation Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0707344915 G -> A LOC_Os07g12830.3 upstream_gene_variant ; 2891.0bp to feature; MODIFIER silent_mutation Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0707344915 G -> A LOC_Os07g12820-LOC_Os07g12830 intergenic_region ; MODIFIER silent_mutation Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0707344915 G -> C LOC_Os07g12830.1 upstream_gene_variant ; 2839.0bp to feature; MODIFIER silent_mutation Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0707344915 G -> C LOC_Os07g12830.2 upstream_gene_variant ; 2891.0bp to feature; MODIFIER silent_mutation Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0707344915 G -> C LOC_Os07g12830.3 upstream_gene_variant ; 2891.0bp to feature; MODIFIER silent_mutation Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0707344915 G -> C LOC_Os07g12820-LOC_Os07g12830 intergenic_region ; MODIFIER silent_mutation Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707344915 NA 1.40E-14 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707344915 NA 4.13E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707344915 NA 1.74E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707344915 NA 2.06E-29 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707344915 NA 1.08E-06 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707344915 NA 1.85E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707344915 NA 9.59E-08 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707344915 NA 4.44E-17 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707344915 NA 1.29E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707344915 NA 1.28E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707344915 NA 5.35E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707344915 NA 1.01E-06 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707344915 NA 1.30E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707344915 NA 1.86E-30 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707344915 3.81E-07 NA mr1055_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707344915 NA 7.83E-16 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251