\
| Variant ID: vg0707344915 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 7344915 |
| Reference Allele: G | Alternative Allele: A,C |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.13, others allele: 0.00, population size: 63. )
AACAATGTTACTATCACTTTGTCGGATGAAGAAACAACCAAAATAAAAGTTATAGATCTTGATGAGTTATAAAACTTTGTTGTTGATAACTTTTTCAGTT[G/A,C]
AAATCATTAATATTTTAAAATATTGTTTGAAGTTGTTATATTTTGAAATTCAAATTCAAACGGTTCAAACAAAGTCATATAGAAAAATGACCAAAATAAA
TTTATTTTGGTCATTTTTCTATATGACTTTGTTTGAACCGTTTGAATTTGAATTTCAAAATATAACAACTTCAAACAATATTTTAAAATATTAATGATTT[C/T,G]
AACTGAAAAAGTTATCAACAACAAAGTTTTATAACTCATCAAGATCTATAACTTTTATTTTGGTTGTTTCTTCATCCGACAAAGTGATAGTAACATTGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.40% | 5.40% | 28.57% | 26.81% | C: 2.86% |
| All Indica | 2759 | 8.30% | 8.50% | 38.20% | 43.13% | C: 1.85% |
| All Japonica | 1512 | 79.20% | 1.00% | 16.40% | 3.44% | NA |
| Aus | 269 | 65.80% | 0.00% | 2.97% | 2.60% | C: 28.62% |
| Indica I | 595 | 2.90% | 4.70% | 34.12% | 58.32% | NA |
| Indica II | 465 | 10.50% | 7.70% | 30.54% | 51.18% | NA |
| Indica III | 913 | 4.80% | 13.30% | 50.60% | 30.23% | C: 1.10% |
| Indica Intermediate | 786 | 15.10% | 6.40% | 31.42% | 41.86% | C: 5.22% |
| Temperate Japonica | 767 | 95.80% | 0.00% | 2.35% | 1.83% | NA |
| Tropical Japonica | 504 | 67.10% | 2.00% | 28.37% | 2.58% | NA |
| Japonica Intermediate | 241 | 51.50% | 2.10% | 36.10% | 10.37% | NA |
| VI/Aromatic | 96 | 78.10% | 0.00% | 19.79% | 0.00% | C: 2.08% |
| Intermediate | 90 | 47.80% | 3.30% | 23.33% | 20.00% | C: 5.56% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0707344915 | G -> DEL | N | N | silent_mutation | Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0707344915 | G -> A | LOC_Os07g12830.1 | upstream_gene_variant ; 2839.0bp to feature; MODIFIER | silent_mutation | Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0707344915 | G -> A | LOC_Os07g12830.2 | upstream_gene_variant ; 2891.0bp to feature; MODIFIER | silent_mutation | Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0707344915 | G -> A | LOC_Os07g12830.3 | upstream_gene_variant ; 2891.0bp to feature; MODIFIER | silent_mutation | Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0707344915 | G -> A | LOC_Os07g12820-LOC_Os07g12830 | intergenic_region ; MODIFIER | silent_mutation | Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0707344915 | G -> C | LOC_Os07g12830.1 | upstream_gene_variant ; 2839.0bp to feature; MODIFIER | silent_mutation | Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0707344915 | G -> C | LOC_Os07g12830.2 | upstream_gene_variant ; 2891.0bp to feature; MODIFIER | silent_mutation | Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0707344915 | G -> C | LOC_Os07g12830.3 | upstream_gene_variant ; 2891.0bp to feature; MODIFIER | silent_mutation | Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0707344915 | G -> C | LOC_Os07g12820-LOC_Os07g12830 | intergenic_region ; MODIFIER | silent_mutation | Average:14.421; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0707344915 | NA | 1.40E-14 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707344915 | NA | 4.13E-13 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707344915 | NA | 1.74E-13 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707344915 | NA | 2.06E-29 | mr1037 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707344915 | NA | 1.08E-06 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707344915 | NA | 1.85E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707344915 | NA | 9.59E-08 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707344915 | NA | 4.44E-17 | mr1147 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707344915 | NA | 1.29E-12 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707344915 | NA | 1.28E-13 | mr1270 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707344915 | NA | 5.35E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707344915 | NA | 1.01E-06 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707344915 | NA | 1.30E-07 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707344915 | NA | 1.86E-30 | mr1037_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707344915 | 3.81E-07 | NA | mr1055_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0707344915 | NA | 7.83E-16 | mr1457_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |