\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707215921:

Variant ID: vg0707215921 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 7215921
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AACCCAACATTAACACCGTAGCGGACTCATAGAAAACTAAGTGTGATGCAGTCAACTAAGAAATCTGCATATGCTTATGGGTTTAAAGTTGGAAACCGCC[G/A]
CTTTTAATGTGTTATGGTTGGTGACAGTTGTGAGCTTGCAATTTGGTAATATTTGCGTGTAACTTAGGTGAATCTTTGAAAACAATTAAAAATTTCAAAA

Reverse complement sequence

TTTTGAAATTTTTAATTGTTTTCAAAGATTCACCTAAGTTACACGCAAATATTACCAAATTGCAAGCTCACAACTGTCACCAACCATAACACATTAAAAG[C/T]
GGCGGTTTCCAACTTTAAACCCATAAGCATATGCAGATTTCTTAGTTGACTGCATCACACTTAGTTTTCTATGAGTCCGCTACGGTGTTAATGTTGGGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.80% 2.20% 1.99% 0.00% NA
All Indica  2759 92.90% 3.80% 3.33% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 77.00% 11.40% 11.60% 0.00% NA
Indica II  465 97.20% 1.90% 0.86% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 94.10% 3.40% 2.42% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707215921 G -> A LOC_Os07g12620.1 downstream_gene_variant ; 550.0bp to feature; MODIFIER silent_mutation Average:38.449; most accessible tissue: Minghui63 root, score: 49.234 N N N N
vg0707215921 G -> A LOC_Os07g12620-LOC_Os07g12630 intergenic_region ; MODIFIER silent_mutation Average:38.449; most accessible tissue: Minghui63 root, score: 49.234 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707215921 1.43E-06 NA Plant_height Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0707215921 NA 3.45E-06 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707215921 NA 2.16E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707215921 NA 4.08E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251