\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707065048:

Variant ID: vg0707065048 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 7065048
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTAAGTGAAAATCGACGGTGAGATTAGATAGTGCCACATGGCAATCCACATGGCGGTCCAGGAGTGTTTGTAGAAGCGCCACTTGGCGACTCGAGAGC[G/A]
TTTATAGGAAGTTTAATGTACTTTTAGTATATAATAGAATAGAATGGATAGATAAGTAAGAGCAATGGCTTGCAGATCACTCTAAAAATACTAATAACCT

Reverse complement sequence

AGGTTATTAGTATTTTTAGAGTGATCTGCAAGCCATTGCTCTTACTTATCTATCCATTCTATTCTATTATATACTAAAAGTACATTAAACTTCCTATAAA[C/T]
GCTCTCGAGTCGCCAAGTGGCGCTTCTACAAACACTCCTGGACCGCCATGTGGATTGCCATGTGGCACTATCTAATCTCACCGTCGATTTTCACTTAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.80% 7.00% 15.28% 44.94% NA
All Indica  2759 4.00% 0.30% 23.34% 72.38% NA
All Japonica  1512 76.80% 20.70% 0.73% 1.79% NA
Aus  269 58.40% 0.40% 16.36% 24.91% NA
Indica I  595 1.70% 0.00% 17.82% 80.50% NA
Indica II  465 6.00% 1.50% 9.46% 83.01% NA
Indica III  913 2.30% 0.10% 33.19% 64.40% NA
Indica Intermediate  786 6.50% 0.00% 24.30% 69.21% NA
Temperate Japonica  767 96.50% 2.70% 0.39% 0.39% NA
Tropical Japonica  504 37.70% 56.70% 1.19% 4.37% NA
Japonica Intermediate  241 95.90% 2.50% 0.83% 0.83% NA
VI/Aromatic  96 86.50% 0.00% 12.50% 1.04% NA
Intermediate  90 42.20% 10.00% 12.22% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0707065048 G -> DEL N N silent_mutation Average:27.099; most accessible tissue: Callus, score: 56.908 N N N N
vg0707065048 G -> A LOC_Os07g12390-LOC_Os07g12400 intergenic_region ; MODIFIER silent_mutation Average:27.099; most accessible tissue: Callus, score: 56.908 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0707065048 3.42E-09 4.24E-31 mr1301 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707065048 NA 8.42E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707065048 2.53E-09 2.25E-24 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707065048 NA 9.89E-12 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707065048 1.17E-09 2.35E-32 mr1301_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707065048 NA 1.53E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707065048 NA 1.29E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707065048 NA 9.49E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707065048 2.20E-10 8.16E-26 mr1410_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707065048 NA 6.75E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707065048 6.55E-06 NA mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707065048 NA 6.26E-08 mr1558_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707065048 NA 2.26E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707065048 NA 5.32E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707065048 2.06E-07 3.83E-18 mr1993_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707065048 NA 2.20E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251