Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707041646:

Variant ID: vg0707041646 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 7041646
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

AATTTTGCGAGTATAGGGGACAAAACCAAACAATACAGCATAGGACCACACGTCCGCAATTCAAACCCAGAGCAATACCATAATGTTTGCACTGCTAGGA[T/C]
ATGATAGCGTCAACGATTGATTGAGAACACGCACAAGTATCTTCTGTCATGAGGCACATATTCTCTATGCCTGCAATATATTCAATATAAAAATCTAATG

Reverse complement sequence

CATTAGATTTTTATATTGAATATATTGCAGGCATAGAGAATATGTGCCTCATGACAGAAGATACTTGTGCGTGTTCTCAATCAATCGTTGACGCTATCAT[A/G]
TCCTAGCAGTGCAAACATTATGGTATTGCTCTGGGTTTGAATTGCGGACGTGTGGTCCTATGCTGTATTGTTTGGTTTTGTCCCCTATACTCGCAAAATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.60%	18.30%	1.08%	0.00%	NA
All Indica	2759	98.10%	1.80%	0.14%	0.00%	NA
All Japonica	1512	44.40%	53.00%	2.65%	0.00%	NA
Aus	269	97.40%	0.70%	1.86%	0.00%	NA
Indica I	595	99.50%	0.30%	0.17%	0.00%	NA
Indica II	465	95.10%	4.90%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	97.10%	2.50%	0.38%	0.00%	NA
Temperate Japonica	767	11.20%	84.90%	3.91%	0.00%	NA
Tropical Japonica	504	85.50%	13.70%	0.79%	0.00%	NA
Japonica Intermediate	241	63.90%	33.60%	2.49%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	16.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0707041646	T -> C	LOC_Os07g12370-LOC_Os07g12380	intergenic_region ; MODIFIER	silent_mutation	Average:29.45; most accessible tissue: Callus, score: 44.476	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0707041646	NA	8.24E-10	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707041646	NA	5.11E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707041646	NA	4.51E-07	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707041646	NA	2.99E-07	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707041646	NA	1.41E-20	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707041646	NA	1.21E-09	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707041646	NA	1.65E-06	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707041646	NA	3.42E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707041646	NA	9.10E-06	mr1672_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707041646	NA	5.27E-12	mr1853_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707041646	2.14E-08	NA	mr1968_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251