Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0707026664:

Variant ID: vg0707026664 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 7026664
Reference Allele: T	Alternative Allele: A,TG,TA
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTACTATATGTCGGGTTCTTTGGCTAAGTAGAAATGATATGGTTTTTAACAAATCCCTAATGAAATCTTATATACAGGTACTATTCAGGATAATGTAC[T/A,TG,TA]
GCTCCAATTTTGACCACAACTATAAAGGTGTAAAGGTGTGATGAGGACAAGGAACTAATATATACTACGTACCAGAAGCTAGAAATAATGGTCATGCAGA

Reverse complement sequence

TCTGCATGACCATTATTTCTAGCTTCTGGTACGTAGTATATATTAGTTCCTTGTCCTCATCACACCTTTACACCTTTATAGTTGTGGTCAAAATTGGAGC[A/T,CA,TA]
GTACATTATCCTGAATAGTACCTGTATATAAGATTTCATTAGGGATTTGTTAAAAACCATATCATTTCTACTTAGCCAAAGAACCCGACATATAGTAGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.40%	7.20%	1.35%	0.00%	NA
All Indica	2759	85.80%	12.00%	2.17%	0.00%	NA
All Japonica	1512	99.70%	0.20%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.50%	0.17%	0.00%	NA
Indica II	465	46.90%	44.30%	8.82%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	83.00%	14.80%	2.29%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	8.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0707026664	T -> TA	LOC_Os07g12360-LOC_Os07g12370	intergenic_region ; MODIFIER	N	Average:42.777; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N
vg0707026664	T -> A	LOC_Os07g12360-LOC_Os07g12370	intergenic_region ; MODIFIER	silent_mutation	Average:42.777; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N
vg0707026664	T -> TG	LOC_Os07g12360-LOC_Os07g12370	intergenic_region ; MODIFIER	N	Average:42.777; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0707026664	NA	3.30E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	9.32E-07	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	4.52E-07	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	4.54E-08	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	2.69E-10	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	4.38E-09	mr1167	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	3.01E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	1.45E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	2.78E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	6.28E-09	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	9.92E-06	mr1543	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	1.43E-09	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	2.03E-06	4.96E-12	mr1726	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	1.66E-06	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	2.18E-09	mr1969	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	1.42E-07	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	3.72E-11	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0707026664	NA	1.15E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251