\
| Variant ID: vg0706897364 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6897364 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCCGGGATCGCTTTTGAGAACAATTGAGTTGAGTTTTGAGTTAGGGTTTCGAGTTTAGTCAAAATTTTTGTAAGGAGTGCTGTTGGTGCACTTTGTAAA[C/T]
ACAAAGAGAATCAATAAAGTCGTCATCTACTTTAAGAGTTTTTCGATTTGTGTTACCAGGTTTCGGCGGTCTAACCGGCGATCTACCGGCGGTCAGACCG
CGGTCTGACCGCCGGTAGATCGCCGGTTAGACCGCCGAAACCTGGTAACACAAATCGAAAAACTCTTAAAGTAGATGACGACTTTATTGATTCTCTTTGT[G/A]
TTTACAAAGTGCACCAACAGCACTCCTTACAAAAATTTTGACTAAACTCGAAACCCTAACTCAAAACTCAACTCAATTGTTCTCAAAAGCGATCCCGGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.20% | 0.90% | 0.93% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 0.00% | 1.27% | 0.00% | NA |
| All Japonica | 1512 | 96.70% | 2.70% | 0.60% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 0.00% | 1.68% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.00% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 97.20% | 0.00% | 2.80% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 91.70% | 7.10% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706897364 | C -> T | LOC_Os07g12280.1 | downstream_gene_variant ; 1804.0bp to feature; MODIFIER | silent_mutation | Average:30.382; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| vg0706897364 | C -> T | LOC_Os07g12270.1 | intron_variant ; MODIFIER | silent_mutation | Average:30.382; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706897364 | NA | 7.17E-07 | mr1232_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706897364 | 5.13E-06 | 5.46E-08 | mr1308_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706897364 | NA | 7.28E-08 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706897364 | 2.62E-07 | 2.62E-07 | mr1424_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706897364 | NA | 1.43E-07 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706897364 | NA | 5.86E-07 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706897364 | 4.91E-06 | 4.91E-06 | mr1562_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706897364 | NA | 1.48E-06 | mr1575_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706897364 | NA | 2.32E-06 | mr1662_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706897364 | NA | 1.57E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706897364 | 7.84E-06 | 1.75E-07 | mr1849_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706897364 | NA | 1.50E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706897364 | NA | 2.30E-08 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706897364 | 1.37E-06 | 3.07E-08 | mr1944_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |