Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0706897364:

Variant ID: vg0706897364 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 6897364
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCCGGGATCGCTTTTGAGAACAATTGAGTTGAGTTTTGAGTTAGGGTTTCGAGTTTAGTCAAAATTTTTGTAAGGAGTGCTGTTGGTGCACTTTGTAAA[C/T]
ACAAAGAGAATCAATAAAGTCGTCATCTACTTTAAGAGTTTTTCGATTTGTGTTACCAGGTTTCGGCGGTCTAACCGGCGATCTACCGGCGGTCAGACCG

Reverse complement sequence

CGGTCTGACCGCCGGTAGATCGCCGGTTAGACCGCCGAAACCTGGTAACACAAATCGAAAAACTCTTAAAGTAGATGACGACTTTATTGATTCTCTTTGT[G/A]
TTTACAAAGTGCACCAACAGCACTCCTTACAAAAATTTTGACTAAACTCGAAACCCTAACTCAAAACTCAACTCAATTGTTCTCAAAAGCGATCCCGGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.20%	0.90%	0.93%	0.00%	NA
All Indica	2759	98.70%	0.00%	1.27%	0.00%	NA
All Japonica	1512	96.70%	2.70%	0.60%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.30%	0.00%	1.68%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.70%	0.00%	0.33%	0.00%	NA
Indica Intermediate	786	97.20%	0.00%	2.80%	0.00%	NA
Temperate Japonica	767	99.60%	0.10%	0.26%	0.00%	NA
Tropical Japonica	504	91.70%	7.10%	1.19%	0.00%	NA
Japonica Intermediate	241	97.90%	1.70%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0706897364	C -> T	LOC_Os07g12280.1	downstream_gene_variant ; 1804.0bp to feature; MODIFIER	silent_mutation	Average:30.382; most accessible tissue: Minghui63 root, score: 41.911	N	N	N	N
vg0706897364	C -> T	LOC_Os07g12270.1	intron_variant ; MODIFIER	silent_mutation	Average:30.382; most accessible tissue: Minghui63 root, score: 41.911	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0706897364	NA	7.17E-07	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706897364	5.13E-06	5.46E-08	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706897364	NA	7.28E-08	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706897364	2.62E-07	2.62E-07	mr1424_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706897364	NA	1.43E-07	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706897364	NA	5.86E-07	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706897364	4.91E-06	4.91E-06	mr1562_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706897364	NA	1.48E-06	mr1575_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706897364	NA	2.32E-06	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706897364	NA	1.57E-09	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706897364	7.84E-06	1.75E-07	mr1849_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706897364	NA	1.50E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706897364	NA	2.30E-08	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706897364	1.37E-06	3.07E-08	mr1944_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251