\
| Variant ID: vg0706854122 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6854122 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACACTAGTGTAGGGATAAAAAATTGACAAAAAACCATACAGGTGTAGAGTAGCAAAACTGTCGGTAACATTAGATCTGAAACGGTAAGCAAATGGTTGTT[G/T]
CTGTACTGGTATACTATTTTTAAATTTTAATAGTGGTTGTCATCACCCTAATCTCATGTATAAAACAACCGCTCTTAAAAACTGGTATACCAAAAAACTA
TAGTTTTTTGGTATACCAGTTTTTAAGAGCGGTTGTTTTATACATGAGATTAGGGTGATGACAACCACTATTAAAATTTAAAAATAGTATACCAGTACAG[C/A]
AACAACCATTTGCTTACCGTTTCAGATCTAATGTTACCGACAGTTTTGCTACTCTACACCTGTATGGTTTTTTGTCAATTTTTTATCCCTACACTAGTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.30% | 8.00% | 6.26% | 50.44% | NA |
| All Indica | 2759 | 11.50% | 0.20% | 7.87% | 80.46% | NA |
| All Japonica | 1512 | 74.30% | 23.70% | 1.59% | 0.40% | NA |
| Aus | 269 | 37.50% | 0.00% | 14.13% | 48.33% | NA |
| Indica I | 595 | 6.40% | 0.00% | 9.75% | 83.87% | NA |
| Indica II | 465 | 14.20% | 0.00% | 5.81% | 80.00% | NA |
| Indica III | 913 | 11.10% | 0.30% | 5.26% | 83.35% | NA |
| Indica Intermediate | 786 | 14.20% | 0.30% | 10.69% | 74.81% | NA |
| Temperate Japonica | 767 | 97.90% | 1.20% | 0.78% | 0.13% | NA |
| Tropical Japonica | 504 | 30.60% | 66.30% | 2.78% | 0.40% | NA |
| Japonica Intermediate | 241 | 90.90% | 6.20% | 1.66% | 1.24% | NA |
| VI/Aromatic | 96 | 84.40% | 0.00% | 13.54% | 2.08% | NA |
| Intermediate | 90 | 50.00% | 16.70% | 4.44% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706854122 | G -> DEL | N | N | silent_mutation | Average:81.842; most accessible tissue: Minghui63 root, score: 93.365 | N | N | N | N |
| vg0706854122 | G -> T | LOC_Os07g12240.1 | upstream_gene_variant ; 2495.0bp to feature; MODIFIER | silent_mutation | Average:81.842; most accessible tissue: Minghui63 root, score: 93.365 | N | N | N | N |
| vg0706854122 | G -> T | LOC_Os07g12230.1 | downstream_gene_variant ; 732.0bp to feature; MODIFIER | silent_mutation | Average:81.842; most accessible tissue: Minghui63 root, score: 93.365 | N | N | N | N |
| vg0706854122 | G -> T | LOC_Os07g12230-LOC_Os07g12240 | intergenic_region ; MODIFIER | silent_mutation | Average:81.842; most accessible tissue: Minghui63 root, score: 93.365 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706854122 | NA | 1.76E-06 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 6.83E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 2.67E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 2.82E-07 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 3.23E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 7.17E-07 | mr1671 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 9.27E-30 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 1.02E-11 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | 3.15E-06 | 1.90E-09 | mr1471_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 1.23E-09 | mr1543_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 7.17E-06 | mr1553_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 4.99E-09 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 7.86E-15 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 4.61E-09 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 6.02E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 4.94E-10 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 6.29E-08 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706854122 | NA | 1.50E-07 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |