Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706643852:

Variant ID: vg0706643852 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 6643852
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTTCTGTTTACCCAAAACACCAATCTCTCTAGGAACACGAAGGTGTTTGCCTTTTGCTAATGTCTTACTACCTCTGTTTTTTAATAGATGACGCCGTT[G/A]
ACTTTTTCTCACATGTTTAACCATTCGTCTTATTCAAAAAAAAAATATGTAATTATAATTATTTTATTATGAGTTCTTTTATCATTTATAGTACTTTAAG

Reverse complement sequence

CTTAAAGTACTATAAATGATAAAAGAACTCATAATAAAATAATTATAATTACATATTTTTTTTTTGAATAAGACGAATGGTTAAACATGTGAGAAAAAGT[C/T]
AACGGCGTCATCTATTAAAAAACAGAGGTAGTAAGACATTAGCAAAAGGCAAACACCTTCGTGTTCCTAGAGAGATTGGTGTTTTGGGTAAACAGAAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.50%	4.00%	5.88%	19.61%	NA
All Indica	2759	53.60%	6.70%	9.86%	29.83%	NA
All Japonica	1512	94.60%	0.00%	0.07%	5.36%	NA
Aus	269	94.80%	0.40%	0.74%	4.09%	NA
Indica I	595	49.90%	9.70%	8.07%	32.27%	NA
Indica II	465	41.10%	12.50%	8.82%	37.63%	NA
Indica III	913	59.50%	2.40%	12.27%	25.85%	NA
Indica Intermediate	786	57.00%	6.00%	9.03%	27.99%	NA
Temperate Japonica	767	90.20%	0.00%	0.13%	9.65%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.40%	NA
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	2.20%	3.33%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0706643852	G -> DEL	N	N	silent_mutation	Average:10.967; most accessible tissue: Minghui63 root, score: 17.665	N	N	N	N
vg0706643852	G -> A	LOC_Os07g11980.1	upstream_gene_variant ; 776.0bp to feature; MODIFIER	silent_mutation	Average:10.967; most accessible tissue: Minghui63 root, score: 17.665	N	N	N	N
vg0706643852	G -> A	LOC_Os07g11990.1	downstream_gene_variant ; 3385.0bp to feature; MODIFIER	silent_mutation	Average:10.967; most accessible tissue: Minghui63 root, score: 17.665	N	N	N	N
vg0706643852	G -> A	LOC_Os07g11980-LOC_Os07g11990	intergenic_region ; MODIFIER	silent_mutation	Average:10.967; most accessible tissue: Minghui63 root, score: 17.665	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0706643852	3.94E-07	2.59E-06	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852	1.85E-06	1.31E-06	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852	NA	3.56E-09	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852	NA	6.68E-06	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852	1.01E-08	1.65E-07	mr1389	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852	1.68E-07	4.48E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852	1.92E-07	1.20E-07	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852	7.59E-07	4.84E-07	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852	NA	1.04E-06	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852	6.72E-07	8.61E-06	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852	2.36E-06	NA	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852	NA	2.13E-07	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852	NA	1.70E-07	mr1743_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251