\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706643852:

Variant ID: vg0706643852 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6643852
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTTCTGTTTACCCAAAACACCAATCTCTCTAGGAACACGAAGGTGTTTGCCTTTTGCTAATGTCTTACTACCTCTGTTTTTTAATAGATGACGCCGTT[G/A]
ACTTTTTCTCACATGTTTAACCATTCGTCTTATTCAAAAAAAAAATATGTAATTATAATTATTTTATTATGAGTTCTTTTATCATTTATAGTACTTTAAG

Reverse complement sequence

CTTAAAGTACTATAAATGATAAAAGAACTCATAATAAAATAATTATAATTACATATTTTTTTTTTGAATAAGACGAATGGTTAAACATGTGAGAAAAAGT[C/T]
AACGGCGTCATCTATTAAAAAACAGAGGTAGTAAGACATTAGCAAAAGGCAAACACCTTCGTGTTCCTAGAGAGATTGGTGTTTTGGGTAAACAGAAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 4.00% 5.88% 19.61% NA
All Indica  2759 53.60% 6.70% 9.86% 29.83% NA
All Japonica  1512 94.60% 0.00% 0.07% 5.36% NA
Aus  269 94.80% 0.40% 0.74% 4.09% NA
Indica I  595 49.90% 9.70% 8.07% 32.27% NA
Indica II  465 41.10% 12.50% 8.82% 37.63% NA
Indica III  913 59.50% 2.40% 12.27% 25.85% NA
Indica Intermediate  786 57.00% 6.00% 9.03% 27.99% NA
Temperate Japonica  767 90.20% 0.00% 0.13% 9.65% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 2.20% 3.33% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706643852 G -> DEL N N silent_mutation Average:10.967; most accessible tissue: Minghui63 root, score: 17.665 N N N N
vg0706643852 G -> A LOC_Os07g11980.1 upstream_gene_variant ; 776.0bp to feature; MODIFIER silent_mutation Average:10.967; most accessible tissue: Minghui63 root, score: 17.665 N N N N
vg0706643852 G -> A LOC_Os07g11990.1 downstream_gene_variant ; 3385.0bp to feature; MODIFIER silent_mutation Average:10.967; most accessible tissue: Minghui63 root, score: 17.665 N N N N
vg0706643852 G -> A LOC_Os07g11980-LOC_Os07g11990 intergenic_region ; MODIFIER silent_mutation Average:10.967; most accessible tissue: Minghui63 root, score: 17.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706643852 3.94E-07 2.59E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852 1.85E-06 1.31E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852 NA 3.56E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852 NA 6.68E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852 1.01E-08 1.65E-07 mr1389 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852 1.68E-07 4.48E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852 1.92E-07 1.20E-07 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852 7.59E-07 4.84E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852 NA 1.04E-06 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852 6.72E-07 8.61E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852 2.36E-06 NA mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852 NA 2.13E-07 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706643852 NA 1.70E-07 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251