| Variant ID: vg0706637813 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6637813 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTAAATAAACAAATTATGTACCGGTATAATACCAATTAATTAGATAGATAGAAATAAGAAAAACTAGAGTTCACTGGGACAAAAGCGATGATACTTCTTG[C/T]
TGCACATCGCTTTCTTGGTCATACTCTGCTCTTTATTTCCAGTCATAGACGTCAACGTACGGTGAAAATCACCCGGAGAAAAGGCAGCGCTGGCAGTGAC
GTCACTGCCAGCGCTGCCTTTTCTCCGGGTGATTTTCACCGTACGTTGACGTCTATGACTGGAAATAAAGAGCAGAGTATGACCAAGAAAGCGATGTGCA[G/A]
CAAGAAGTATCATCGCTTTTGTCCCAGTGAACTCTAGTTTTTCTTATTTCTATCTATCTAATTAATTGGTATTATACCGGTACATAATTTGTTTATTTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.40% | 1.80% | 2.35% | 42.40% | NA |
| All Indica | 2759 | 30.60% | 0.00% | 1.67% | 67.74% | NA |
| All Japonica | 1512 | 84.30% | 5.60% | 3.51% | 6.61% | NA |
| Aus | 269 | 90.70% | 0.00% | 3.72% | 5.58% | NA |
| Indica I | 595 | 36.60% | 0.00% | 1.68% | 61.68% | NA |
| Indica II | 465 | 16.30% | 0.00% | 2.58% | 81.08% | NA |
| Indica III | 913 | 27.50% | 0.00% | 1.10% | 71.41% | NA |
| Indica Intermediate | 786 | 37.90% | 0.10% | 1.78% | 60.18% | NA |
| Temperate Japonica | 767 | 73.50% | 9.00% | 5.74% | 11.73% | NA |
| Tropical Japonica | 504 | 97.80% | 1.40% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 90.00% | 3.70% | 3.32% | 2.90% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 1.10% | 2.22% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706637813 | C -> DEL | N | N | silent_mutation | Average:10.117; most accessible tissue: Callus, score: 52.796 | N | N | N | N |
| vg0706637813 | C -> T | LOC_Os07g11970.1 | upstream_gene_variant ; 2410.0bp to feature; MODIFIER | silent_mutation | Average:10.117; most accessible tissue: Callus, score: 52.796 | N | N | N | N |
| vg0706637813 | C -> T | LOC_Os07g11980.1 | downstream_gene_variant ; 3832.0bp to feature; MODIFIER | silent_mutation | Average:10.117; most accessible tissue: Callus, score: 52.796 | N | N | N | N |
| vg0706637813 | C -> T | LOC_Os07g11970-LOC_Os07g11980 | intergenic_region ; MODIFIER | silent_mutation | Average:10.117; most accessible tissue: Callus, score: 52.796 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706637813 | 9.61E-06 | 9.61E-06 | mr1480 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706637813 | 7.50E-08 | 2.77E-07 | mr1692 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706637813 | NA | 1.72E-06 | mr1896 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706637813 | 7.33E-06 | 7.33E-06 | mr1907 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706637813 | 1.18E-06 | 1.51E-07 | mr1968 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |