Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706562154:

Variant ID: vg0706562154 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 6562154
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTCGTGATTGTGCCACTTTTAGACGGTCTCGAATCAGGTGAACCTTTTCTTCGGCTTCTTTGATAATGTCAGGTCCAAATACCGCCCGTTCACCTGTCT[T/C]
GGTCCACATTAGTGGGGTATGACATCATCGACCAAATAATGCCTCATTTGGTGGCATCTTTAGGCTCGCTTGGAAACTGTTGTTGTAGGAGAATTCGGCG

Reverse complement sequence

CGCCGAATTCTCCTACAACAACAGTTTCCAAGCGAGCCTAAAGATGCCACCAAATGAGGCATTATTTGGTCGATGATGTCATACCCCACTAATGTGGACC[A/G]
AGACAGGTGAACGGGCGGTATTTGGACCTGACATTATCAAAGAAGCCGAAGAAAAGGTTCACCTGATTCGAGACCGTCTAAAAGTGGCACAATCACGACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.20%	36.40%	7.72%	3.68%	NA
All Indica	2759	27.50%	59.20%	9.39%	3.84%	NA
All Japonica	1512	98.10%	0.80%	0.66%	0.40%	NA
Aus	269	29.00%	20.40%	30.48%	20.07%	NA
Indica I	595	52.40%	43.70%	3.53%	0.34%	NA
Indica II	465	31.40%	58.50%	7.31%	2.80%	NA
Indica III	913	6.10%	73.70%	14.46%	5.70%	NA
Indica Intermediate	786	31.30%	54.60%	9.16%	4.96%	NA
Temperate Japonica	767	97.40%	1.00%	1.17%	0.39%	NA
Tropical Japonica	504	99.40%	0.40%	0.20%	0.00%	NA
Japonica Intermediate	241	97.90%	0.80%	0.00%	1.24%	NA
VI/Aromatic	96	87.50%	1.00%	8.33%	3.12%	NA
Intermediate	90	70.00%	17.80%	6.67%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0706562154	T -> DEL	N	N	silent_mutation	Average:10.442; most accessible tissue: Zhenshan97 young leaf, score: 17.571	N	N	N	N
vg0706562154	T -> C	LOC_Os07g11860.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:10.442; most accessible tissue: Zhenshan97 young leaf, score: 17.571	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0706562154	NA	1.51E-27	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	7.66E-30	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	1.77E-78	mr1100	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	1.23E-40	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	4.13E-30	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	1.05E-06	NA	mr1395	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	7.56E-18	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	5.29E-06	NA	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	2.10E-56	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	1.26E-55	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	1.04E-59	mr1962	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	1.38E-37	mr1072_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	2.98E-32	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	7.81E-36	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	2.62E-41	mr1145_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	4.32E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	3.07E-24	mr1233_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	4.78E-29	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	7.02E-18	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	5.88E-17	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	4.64E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	1.10E-25	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	5.18E-17	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	6.17E-24	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	2.84E-98	mr1619_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	5.79E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	1.55E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	2.02E-88	mr1795_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	6.31E-33	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	7.11E-20	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	3.52E-24	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706562154	NA	4.14E-19	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251