Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706531615:

Variant ID: vg0706531615 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 6531615
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

CCATCCCATGATTTCCCGCAAAACTCATAGATAAGAATGAATGTGTAGCACCAGAATCGAAAAGCACTGTTGCAGGAACTAAGTTAACAAGAAACGTACC[A/C]
AAAATCACATCTGGAGCATCTTGAGCTTCTGCAGCAGCGACATGATTGACACGGGCCTTTGATGCTGGTACAGTAGAGTTGCTCTGGGCAGGGACAACCT

Reverse complement sequence

AGGTTGTCCCTGCCCAGAGCAACTCTACTGTACCAGCATCAAAGGCCCGTGTCAATCATGTCGCTGCTGCAGAAGCTCAAGATGCTCCAGATGTGATTTT[T/G]
GGTACGTTTCTTGTTAACTTAGTTCCTGCAACAGTGCTTTTCGATTCTGGTGCTACACATTCATTCTTATCTATGAGTTTTGCGGGAAATCATGGGATGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.10%	5.60%	9.42%	3.89%	NA
All Indica	2759	70.10%	9.30%	14.53%	6.13%	NA
All Japonica	1512	99.40%	0.10%	0.13%	0.40%	NA
Aus	269	84.40%	2.20%	12.27%	1.12%	NA
Indica I	595	72.80%	13.40%	10.92%	2.86%	NA
Indica II	465	72.30%	1.90%	18.71%	7.10%	NA
Indica III	913	65.50%	11.30%	16.43%	6.79%	NA
Indica Intermediate	786	72.00%	8.10%	12.60%	7.25%	NA
Temperate Japonica	767	99.00%	0.00%	0.26%	0.78%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	0.00%	1.04%	1.04%	NA
Intermediate	90	85.60%	0.00%	8.89%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0706531615	A -> DEL	LOC_Os07g11800.1	N	frameshift_variant	Average:14.62; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0706531615	A -> C	LOC_Os07g11800.1	missense_variant ; p.Phe365Leu; MODERATE	nonsynonymous_codon ; F365L	Average:14.62; most accessible tissue: Minghui63 panicle, score: 20.733	benign	-0.92	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0706531615	NA	4.50E-27	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	1.85E-28	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	3.88E-29	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	8.74E-27	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	4.67E-28	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	4.90E-18	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	1.04E-51	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	1.83E-53	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	2.58E-13	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	9.79E-06	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	3.19E-38	mr1072_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	7.89E-37	mr1075_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	7.90E-99	mr1100_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	3.54E-54	mr1124_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	1.38E-32	mr1238_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	1.91E-17	mr1281_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	1.03E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	3.01E-61	mr1402_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	5.47E-29	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	1.55E-10	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	9.56E-17	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	2.19E-25	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	3.79E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	1.89E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	8.31E-86	mr1795_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	3.97E-37	mr1841_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	3.84E-23	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	4.03E-27	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706531615	NA	5.91E-22	mr1945_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251