\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706513088:

Variant ID: vg0706513088 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6513088
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGAGAGTAGAGTAGAAGAAGTCGGAAGAATTCCGGAGTTGTTGGTAATCTTCTCTCATTTCTTTTTTTCTGTTCATTACTCTGATTTCAATATAATATT[T/C]
TTCTTGAGTAATTTAGATTTATCTTGTGAGAATTATCTCTTGGTTAGTTTCTAAATAGCGTACGGGATTATTGTTCACTATAATCAACTGAAATATAGTG

Reverse complement sequence

CACTATATTTCAGTTGATTATAGTGAACAATAATCCCGTACGCTATTTAGAAACTAACCAAGAGATAATTCTCACAAGATAAATCTAAATTACTCAAGAA[A/G]
AATATTATATTGAAATCAGAGTAATGAACAGAAAAAAAGAAATGAGAGAAGATTACCAACAACTCCGGAATTCTTCCGACTTCTTCTACTCTACTCTCTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.70% 24.10% 23.76% 5.48% NA
All Indica  2759 20.20% 37.20% 36.14% 6.49% NA
All Japonica  1512 94.50% 0.10% 0.53% 4.83% NA
Aus  269 27.10% 37.90% 34.57% 0.37% NA
Indica I  595 32.60% 27.90% 34.29% 5.21% NA
Indica II  465 20.90% 28.80% 46.67% 3.66% NA
Indica III  913 10.20% 50.90% 30.67% 8.21% NA
Indica Intermediate  786 22.10% 33.10% 37.66% 7.12% NA
Temperate Japonica  767 90.10% 0.00% 0.39% 9.52% NA
Tropical Japonica  504 99.40% 0.00% 0.60% 0.00% NA
Japonica Intermediate  241 98.30% 0.80% 0.83% 0.00% NA
VI/Aromatic  96 92.70% 3.10% 2.08% 2.08% NA
Intermediate  90 63.30% 6.70% 25.56% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706513088 T -> DEL N N silent_mutation Average:11.656; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0706513088 T -> C LOC_Os07g11780.1 downstream_gene_variant ; 491.0bp to feature; MODIFIER silent_mutation Average:11.656; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0706513088 T -> C LOC_Os07g11790.1 downstream_gene_variant ; 2534.0bp to feature; MODIFIER silent_mutation Average:11.656; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0706513088 T -> C LOC_Os07g11780-LOC_Os07g11790 intergenic_region ; MODIFIER silent_mutation Average:11.656; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706513088 NA 7.17E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 NA 6.06E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 NA 2.16E-11 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 9.72E-06 5.85E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 NA 5.14E-17 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 NA 6.62E-15 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 5.89E-06 1.18E-17 mr1326_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 2.10E-06 7.89E-07 mr1326_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 NA 1.20E-18 mr1333_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 NA 3.21E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 NA 2.55E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 NA 1.79E-09 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 NA 3.00E-06 mr1623_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 NA 4.69E-17 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 NA 3.68E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 NA 9.16E-16 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 5.35E-06 5.35E-06 mr1744_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088 NA 1.34E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251