Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0706513088:

Variant ID: vg0706513088 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 6513088
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGAGAGTAGAGTAGAAGAAGTCGGAAGAATTCCGGAGTTGTTGGTAATCTTCTCTCATTTCTTTTTTTCTGTTCATTACTCTGATTTCAATATAATATT[T/C]
TTCTTGAGTAATTTAGATTTATCTTGTGAGAATTATCTCTTGGTTAGTTTCTAAATAGCGTACGGGATTATTGTTCACTATAATCAACTGAAATATAGTG

Reverse complement sequence

CACTATATTTCAGTTGATTATAGTGAACAATAATCCCGTACGCTATTTAGAAACTAACCAAGAGATAATTCTCACAAGATAAATCTAAATTACTCAAGAA[A/G]
AATATTATATTGAAATCAGAGTAATGAACAGAAAAAAAGAAATGAGAGAAGATTACCAACAACTCCGGAATTCTTCCGACTTCTTCTACTCTACTCTCTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.70%	24.10%	23.76%	5.48%	NA
All Indica	2759	20.20%	37.20%	36.14%	6.49%	NA
All Japonica	1512	94.50%	0.10%	0.53%	4.83%	NA
Aus	269	27.10%	37.90%	34.57%	0.37%	NA
Indica I	595	32.60%	27.90%	34.29%	5.21%	NA
Indica II	465	20.90%	28.80%	46.67%	3.66%	NA
Indica III	913	10.20%	50.90%	30.67%	8.21%	NA
Indica Intermediate	786	22.10%	33.10%	37.66%	7.12%	NA
Temperate Japonica	767	90.10%	0.00%	0.39%	9.52%	NA
Tropical Japonica	504	99.40%	0.00%	0.60%	0.00%	NA
Japonica Intermediate	241	98.30%	0.80%	0.83%	0.00%	NA
VI/Aromatic	96	92.70%	3.10%	2.08%	2.08%	NA
Intermediate	90	63.30%	6.70%	25.56%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0706513088	T -> DEL	N	N	silent_mutation	Average:11.656; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0706513088	T -> C	LOC_Os07g11780.1	downstream_gene_variant ; 491.0bp to feature; MODIFIER	silent_mutation	Average:11.656; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0706513088	T -> C	LOC_Os07g11790.1	downstream_gene_variant ; 2534.0bp to feature; MODIFIER	silent_mutation	Average:11.656; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0706513088	T -> C	LOC_Os07g11780-LOC_Os07g11790	intergenic_region ; MODIFIER	silent_mutation	Average:11.656; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0706513088	NA	7.17E-13	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	NA	6.06E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	NA	2.16E-11	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	9.72E-06	5.85E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	NA	5.14E-17	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	NA	6.62E-15	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	5.89E-06	1.18E-17	mr1326_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	2.10E-06	7.89E-07	mr1326_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	NA	1.20E-18	mr1333_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	NA	3.21E-08	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	NA	2.55E-22	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	NA	1.79E-09	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	NA	3.00E-06	mr1623_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	NA	4.69E-17	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	NA	3.68E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	NA	9.16E-16	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	5.35E-06	5.35E-06	mr1744_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706513088	NA	1.34E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251