\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706319441:

Variant ID: vg0706319441 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6319441
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATATTTAAAATAATACAATAAATAATTTGTGACACATAAATAGGTCTTATGACATAGTAAATATTGTCACTGGATGACACTAGACTAGCTATATGACA[C/T]
TTATTGTGACACACAACTTTTTATTGTCATTAAGTTAAAATGCTTCAAATAAAATGTCATAAATTAGATGATATAGTGACATTATAACCTGTGTCATATA

Reverse complement sequence

TATATGACACAGGTTATAATGTCACTATATCATCTAATTTATGACATTTTATTTGAAGCATTTTAACTTAATGACAATAAAAAGTTGTGTGTCACAATAA[G/A]
TGTCATATAGCTAGTCTAGTGTCATCCAGTGACAATATTTACTATGTCATAAGACCTATTTATGTGTCACAAATTATTTATTGTATTATTTTAAATATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 11.60% 2.88% 12.34% NA
All Indica  2759 92.30% 1.60% 2.21% 3.91% NA
All Japonica  1512 45.70% 32.30% 3.70% 18.25% NA
Aus  269 23.80% 0.40% 5.58% 70.26% NA
Indica I  595 90.30% 2.70% 4.20% 2.86% NA
Indica II  465 94.40% 3.40% 2.15% 0.00% NA
Indica III  913 95.80% 0.30% 0.22% 3.61% NA
Indica Intermediate  786 88.40% 1.10% 3.05% 7.38% NA
Temperate Japonica  767 21.40% 47.60% 4.95% 26.08% NA
Tropical Japonica  504 79.60% 7.30% 1.59% 11.51% NA
Japonica Intermediate  241 52.30% 36.10% 4.15% 7.47% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 70.00% 16.70% 4.44% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706319441 C -> DEL N N silent_mutation Average:86.007; most accessible tissue: Callus, score: 97.047 N N N N
vg0706319441 C -> T LOC_Os07g11490.1 upstream_gene_variant ; 1384.0bp to feature; MODIFIER silent_mutation Average:86.007; most accessible tissue: Callus, score: 97.047 N N N N
vg0706319441 C -> T LOC_Os07g11490.2 upstream_gene_variant ; 1382.0bp to feature; MODIFIER silent_mutation Average:86.007; most accessible tissue: Callus, score: 97.047 N N N N
vg0706319441 C -> T LOC_Os07g11490.3 upstream_gene_variant ; 2204.0bp to feature; MODIFIER silent_mutation Average:86.007; most accessible tissue: Callus, score: 97.047 N N N N
vg0706319441 C -> T LOC_Os07g11490-LOC_Os07g11500 intergenic_region ; MODIFIER silent_mutation Average:86.007; most accessible tissue: Callus, score: 97.047 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0706319441 C T -0.08 -0.04 -0.04 -0.06 -0.07 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706319441 NA 4.26E-06 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706319441 3.50E-07 NA mr1115 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706319441 NA 3.10E-06 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706319441 NA 3.15E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706319441 4.02E-06 NA mr1611 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706319441 NA 1.60E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251