\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706282472:

Variant ID: vg0706282472 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 6282472
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.16, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TGCGCCGAATTGTATTGATCGTGGAGATAGATTACATAGACCCTGGGTGTACATATTTATACCCATGGGTTGATACAAGTCCTTGTCGGACAAGAAAGAA[G/A]
CTTTCCTAAAGATAAAAGGAAAAGATAAAGTCCTTATAGGACACTAAACACACTTTCCTAAAGATAAAAGGAAACTAACAAACTATTTCTAATTAATAGA

Reverse complement sequence

TCTATTAATTAGAAATAGTTTGTTAGTTTCCTTTTATCTTTAGGAAAGTGTGTTTAGTGTCCTATAAGGACTTTATCTTTTCCTTTTATCTTTAGGAAAG[C/T]
TTCTTTCTTGTCCGACAAGGACTTGTATCAACCCATGGGTATAAATATGTACACCCAGGGTCTATGTAATCTATCTCCACGATCAATACAATTCGGCGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.40% 11.50% 0.78% 12.36% NA
All Indica  2759 79.00% 16.60% 0.72% 3.73% NA
All Japonica  1512 77.80% 2.80% 0.33% 18.98% NA
Aus  269 13.80% 14.10% 3.35% 68.77% NA
Indica I  595 77.30% 19.30% 0.84% 2.52% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 72.60% 23.10% 1.10% 3.18% NA
Indica Intermediate  786 75.60% 16.30% 0.64% 7.51% NA
Temperate Japonica  767 67.40% 5.10% 0.26% 27.25% NA
Tropical Japonica  504 87.50% 0.00% 0.60% 11.90% NA
Japonica Intermediate  241 90.90% 1.70% 0.00% 7.47% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 84.40% 4.40% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0706282472 G -> DEL N N silent_mutation Average:34.47; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 N N N N
vg0706282472 G -> A LOC_Os07g11420.1 upstream_gene_variant ; 1110.0bp to feature; MODIFIER silent_mutation Average:34.47; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 N N N N
vg0706282472 G -> A LOC_Os07g11410-LOC_Os07g11420 intergenic_region ; MODIFIER silent_mutation Average:34.47; most accessible tissue: Zhenshan97 flag leaf, score: 53.795 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0706282472 NA 3.20E-07 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706282472 NA 1.62E-06 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706282472 NA 3.90E-07 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706282472 NA 1.54E-06 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706282472 NA 1.92E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706282472 NA 5.87E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706282472 NA 2.59E-07 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706282472 NA 3.20E-09 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706282472 NA 9.90E-08 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706282472 NA 2.30E-06 mr1806 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706282472 NA 3.41E-06 mr1875 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706282472 NA 2.20E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706282472 NA 8.33E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706282472 NA 2.22E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251