Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706195526:

Variant ID: vg0706195526 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 6195526
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTTCGGACTTGTCCGAATAGTTTTCGGAATGTCCGAAAAATCCTTCCATGACCAAACTGTTGGTGCTGAGCTAGAATTTTTCGGACATGTCCGAAAAT[C/T,A]
TTTCGGAATATCCGAAAATCTCAATTATTGTGCATAACGGGCAGAATCTGGGCTGTGGCTATAAATAGCCCCCTCCCCTCACTTGTGAGGGCTGCTGGTT

Reverse complement sequence

AACCAGCAGCCCTCACAAGTGAGGGGAGGGGGCTATTTATAGCCACAGCCCAGATTCTGCCCGTTATGCACAATAATTGAGATTTTCGGATATTCCGAAA[G/A,T]
ATTTTCGGACATGTCCGAAAAATTCTAGCTCAGCACCAACAGTTTGGTCATGGAAGGATTTTTCGGACATTCCGAAAACTATTCGGACAAGTCCGAAAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	10.30%	0.21%	0.00%	NA
All Indica	2759	83.50%	16.20%	0.29%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	87.40%	11.90%	0.74%	0.00%	NA
Indica I	595	80.70%	19.00%	0.34%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	76.60%	22.90%	0.55%	0.00%	NA
Indica Intermediate	786	84.10%	15.80%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0706195526	C -> A	LOC_Os07g11240.1	downstream_gene_variant ; 1176.0bp to feature; MODIFIER	N	Average:37.543; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N
vg0706195526	C -> A	LOC_Os07g11240-LOC_Os07g11250	intergenic_region ; MODIFIER	N	Average:37.543; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N
vg0706195526	C -> T	LOC_Os07g11240.1	downstream_gene_variant ; 1176.0bp to feature; MODIFIER	silent_mutation	Average:37.543; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N
vg0706195526	C -> T	LOC_Os07g11240-LOC_Os07g11250	intergenic_region ; MODIFIER	silent_mutation	Average:37.543; most accessible tissue: Zhenshan97 flag leaf, score: 46.427	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0706195526	NA	5.76E-07	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706195526	NA	1.49E-06	mr1177	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706195526	NA	1.85E-06	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706195526	NA	3.10E-06	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706195526	NA	9.55E-06	mr1220	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706195526	NA	3.44E-07	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706195526	NA	3.84E-06	mr1422	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706195526	NA	1.75E-11	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706195526	NA	4.38E-09	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706195526	NA	6.67E-09	mr1740	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706195526	NA	4.69E-07	mr1806	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706195526	NA	3.99E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706195526	NA	1.55E-06	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706195526	NA	2.16E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706195526	NA	1.65E-14	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706195526	NA	2.72E-11	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251