Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0705963719:

Variant ID: vg0705963719 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 5963719
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGACGATGTGCTTGACTGTGACGGTGGTCGTAGCAGTGGGAGTCGTGGTTGACGATGAGGCGTGGCGCATTCCCGTCACTGGCTGCGCCCCCTCTCGATC[G/A]
GATTAGGGTTTGTGGGGTGGAGTGGTTGCGGCGATGAACCTCGTTTCTTGTGCCGTCCCGTCCTCCACCCCTCTTTATATGGCACAGTATGACGGGGGCC

Reverse complement sequence

GGCCCCCGTCATACTGTGCCATATAAAGAGGGGTGGAGGACGGGACGGCACAAGAAACGAGGTTCATCGCCGCAACCACTCCACCCCACAAACCCTAATC[C/T]
GATCGAGAGGGGGCGCAGCCAGTGACGGGAATGCGCCACGCCTCATCGTCAACCACGACTCCCACTGCTACGACCACCGTCACAGTCAAGCACATCGTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.10%	4.10%	13.18%	42.68%	NA
All Indica	2759	15.50%	0.30%	12.65%	71.55%	NA
All Japonica	1512	91.50%	5.80%	2.45%	0.26%	NA
Aus	269	11.20%	0.00%	81.04%	7.81%	NA
Indica I	595	15.30%	0.00%	9.08%	75.63%	NA
Indica II	465	12.90%	0.00%	10.97%	76.13%	NA
Indica III	913	14.80%	0.30%	11.50%	73.38%	NA
Indica Intermediate	786	18.20%	0.50%	17.68%	63.61%	NA
Temperate Japonica	767	95.40%	1.20%	3.26%	0.13%	NA
Tropical Japonica	504	92.50%	6.50%	0.60%	0.40%	NA
Japonica Intermediate	241	76.80%	19.10%	3.73%	0.41%	NA
VI/Aromatic	96	8.30%	88.50%	2.08%	1.04%	NA
Intermediate	90	47.80%	14.40%	18.89%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0705963719	G -> DEL	N	N	silent_mutation	Average:38.24; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N
vg0705963719	G -> A	LOC_Os07g10900.1	upstream_gene_variant ; 344.0bp to feature; MODIFIER	silent_mutation	Average:38.24; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N
vg0705963719	G -> A	LOC_Os07g10900-LOC_Os07g10910	intergenic_region ; MODIFIER	silent_mutation	Average:38.24; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0705963719	NA	3.58E-06	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705963719	1.42E-06	NA	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705963719	4.41E-07	NA	mr1618	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705963719	NA	6.64E-09	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251